Question 1: Which of the following is true about an enzyme at its optimal pH?

• The enzyme has maximum catalytic activity (Correct answer)
• The enzyme is permanently denatured
• The enzyme's active site is blocked by inhibitors
• The enzyme converts substrate to product at its slowest rate

Correct answer: The enzyme has maximum catalytic activity

At its optimal pH, the ionization states of the enzyme's active site residues are ideal for substrate binding and catalysis, maximizing reaction rate.

Question 2: Which type of isomerism is exhibited by cis- and trans-2-butene?

• Geometric (cis/trans) isomerism (Correct answer)
• Constitutional isomerism
• Conformational isomerism
• Enantiomerism

Correct answer: Geometric (cis/trans) isomerism

Cis- and trans-2-butene are geometric isomers because they have the same connectivity but differ in the spatial arrangement of groups around the double bond.

Question 3: In the first paragraph, the author most usually omits particular details of the events in order to:

• downplay the significance of the events being addressed.
• conceal a general lack of knowledge on the subject matter.
• set an expectation that is reversed in the following paragraph. (Correct answer)
• express the primary thesis of the passage more concisely.

Correct answer: set an expectation that is reversed in the following paragraph.

The first paragraph describes popular uprisings against taxation and economic hardship, using language that strongly suggests the American Revolution. However, the second paragraph immediately clarifies, 'These popular uprisings... were not... revolts against the British monarchy... Rather, Shays' Rebellion... occurred after the British had been vanquished.' This deliberate setup and subsequent reversal of the reader's likely initial assumption is a rhetorical device to highlight the author's main point about post-Revolutionary rebellions.

Question 4: Which of the following best defines genetic drift?

• Directed change in allele frequencies due to differential reproductive success
• Changes in allele frequencies caused by new mutations
• Movement of alleles between populations through migration
• Random fluctuations in allele frequencies due to chance events, especially in small populations (Correct answer)

Correct answer: Random fluctuations in allele frequencies due to chance events, especially in small populations

Genetic drift refers to stochastic, non-directional changes in allele frequencies caused by random sampling events, with its effects most pronounced in small populations.

Question 5: Which organelle is responsible for modifying, sorting, and packaging proteins for secretion?

• Mitochondria
• Golgi apparatus (Correct answer)
• Rough endoplasmic reticulum
• Lysosome

Correct answer: Golgi apparatus

The Golgi apparatus receives proteins from the ER, modifies them (e.g., glycosylation), and sorts them into vesicles destined for the cell membrane, lysosomes, or secretion.

Question 6: Broca's area, responsible for speech production, is located in which lobe of the brain?

• Frontal lobe (Correct answer)
• Temporal lobe
• Parietal lobe
• Occipital lobe

Correct answer: Frontal lobe

Broca's area is located in the inferior frontal gyrus of the frontal lobe (Brodmann areas 44 and 45).

Question 7: One day, while doing treatments in his clinic, a dentist is summoned to the front desk to resolve a conflict between one of his patients and the receptionist. The patient is a middle-aged businessman who is upset and making a disturbance because he was told he would have to visit a dental hygienist rather than a dentist. The patient screams angrily that he earns far too much money to be treated by an inexperienced colleague. The clerk informs the dentist that the patient was 40 minutes late for his appointment and that the hygienist was now the only available appointment time.The patient retaliates by saying that his time is more valuable than everyone else's. What type of personality problem do you think this patient has?

• Obsessive-compulsive
• Narcissistic (Correct answer)
• Paranoid
• Histrionic

Correct answer: Narcissistic

The patient's behavior—demanding special treatment, expressing grandiosity about his income, believing his time is more valuable, and reacting with anger when his perceived status is challenged—are classic indicators of Narcissistic Personality Disorder. This disorder is characterized by a pervasive pattern of grandiosity, a need for admiration, and a lack of empathy.

Question 8: Which of the following scenarios best exemplifies 'role conflict'?

• A physician who transitions from clinical practice to hospital administration
• A surgeon who performs procedures she finds ethically questionable because hospital policy requires it
• A medical resident who must choose between staying to care for a critical patient or attending their child's school play (Correct answer)
• A nurse who must adapt their communication style for different patients

Correct answer: A medical resident who must choose between staying to care for a critical patient or attending their child's school play

Role conflict occurs when the demands of two or more social roles a person holds are incompatible, requiring a choice between competing obligations.

Question 9: An author presents evidence that bilingual children outperform monolingual children on certain cognitive tasks, then concludes that 'all children should be taught a second language.' This reasoning is flawed because:

• The conclusion overgeneralizes from a specific cognitive benefit to a broad educational policy recommendation (Correct answer)
• The study did not account for socioeconomic differences between groups
• The author ignores that correlation between bilingualism and performance does not prove bilingualism causes improved cognition
• The sample size of bilingual children studied was too small

Correct answer: The conclusion overgeneralizes from a specific cognitive benefit to a broad educational policy recommendation

Even if bilingualism correlates with cognitive benefits, the leap to a universal educational mandate is an overgeneralization that the evidence does not fully support.

Question 10: In recombinant DNA technology, restriction endonucleases are primarily used to:

• Synthesize new DNA strands from an RNA template
• Amplify a specific DNA sequence exponentially
• Cut DNA at specific palindromic recognition sequences (Correct answer)
• Join two DNA fragments with compatible ends

Correct answer: Cut DNA at specific palindromic recognition sequences

Restriction endonucleases recognize specific short DNA sequences (typically 4–8 bp palindromes) and cleave the DNA at or near those sites, generating defined fragments for cloning or analysis.

Question 11: In Mendelian genetics, two heterozygous parents (Aa × Aa) produce offspring. What fraction of offspring would display the recessive phenotype?

• 1/2
• 1/8
• 1/4 (Correct answer)
• 3/4

Correct answer: 1/4

A monohybrid cross of Aa × Aa yields a 3:1 phenotypic ratio (3 dominant: 1 recessive), so 1/4 of offspring display the recessive phenotype (aa).

Question 12: A CARS passage states: 'The Renaissance was not a sudden awakening but a gradual accumulation of classical rediscoveries.' The author's view most directly challenges which assumption?

• That the Renaissance represented a sharp, discontinuous break from the medieval period (Correct answer)
• That humanism was the defining ideology of Renaissance thinkers
• That Italian city-states were the primary patrons of Renaissance art
• That classical texts had no influence on medieval scholars

Correct answer: That the Renaissance represented a sharp, discontinuous break from the medieval period

By framing the Renaissance as gradual accumulation, the author disputes the conventional picture of it as a sudden, transformative rupture with the past.

Question 13: Which professional attribute is most valued in psychology within the MCAT field?

• Prioritizing personal convenience
• Working in isolation
• Accountability and commitment to standards (Correct answer)
• Avoiding challenging situations

Correct answer: Accountability and commitment to standards

Accountability and commitment to professional standards build trust and ensure consistent, high-quality practice.

Question 14: What is the Michaelis constant (Km) a measure of?

• Enzyme concentration
• Maximum reaction velocity
• Product inhibition strength
• Substrate affinity for the enzyme (Correct answer)

Correct answer: Substrate affinity for the enzyme

Km is the substrate concentration at which reaction velocity is half of Vmax; a lower Km indicates higher affinity of the enzyme for its substrate.

Question 15: A person who has experienced a traumatic car accident now feels intense anxiety whenever they hear screeching brakes, even in safe contexts. From a behavioral perspective, this anxiety represents:

• An operantly conditioned avoidance response
• A classically conditioned fear response (CR) to a conditioned stimulus (CS) (Correct answer)
• A generalization of instrumental behavior
• Observational learning from watching others' accidents

Correct answer: A classically conditioned fear response (CR) to a conditioned stimulus (CS)

The screeching brakes (CS) were paired with the trauma (UCS), producing a conditioned fear response (CR) through classical conditioning.

Question 16: On the third day of an evolution symposium, two scientists take the stage to debate their beliefs. Each is a passionate follower of their respective philosophy. According to the first scientist, organisms evolved by increasing the number of organs that were employed the most at the time. They'd then pass them down to future generations. The second scientist, on the other hand, believed that each organism's advantages were absent for a long time, then appeared at random, and when they were helpful, that organism would swiftly populate the population over a short period of time, according to evolution. Which of the following statements would support the argument of the second scientist?

• A study that showed a consistent amount of time between the emergence of each new species.
• A study that shows that bodybuilders who train more have larger children.
• A taxonomy study that shows long periods of stagnant growth followed by short burst of massive evolution. (Correct answer)
• A study that showed a species who were more successful due to the things they learned over their lifetime that they passed on to their children.

Correct answer: A taxonomy study that shows long periods of stagnant growth followed by short burst of massive evolution.

Scientist 2's view aligns with the theory of punctuated equilibrium, which proposes that evolution is characterized by long periods of little or no change (stasis) interrupted by brief periods of rapid speciation and evolutionary change. Therefore, a taxonomy study showing long periods of stagnant growth followed by short bursts of massive evolution would directly support the argument of the second scientist.

Question 17: In a feedback inhibition pathway, the end product of a biosynthetic pathway typically inhibits which enzyme?

• A downstream enzyme in a parallel pathway
• The enzyme that produced it directly
• The first (committed) step enzyme (Correct answer)
• The last enzyme in the pathway

Correct answer: The first (committed) step enzyme

End-product (feedback) inhibition classically targets the first committed step of the pathway, preventing wasteful synthesis when the product is abundant.

Question 18: The equation below explains how ammonia is produced:

• Increasing pressure (Correct answer)
• Decreasing pressure
• Increasing temperature
• Increasing the amount of ammonia (NH3)
• Decreasing the amount of hydrogen

Correct answer: Increasing pressure

The Haber-Bosch process for ammonia synthesis is N2(g) + 3H2(g) <=> 2NH3(g). This reaction involves 4 moles of gas on the reactant side and 2 moles of gas on the product side. According to Le Chatelier's Principle, increasing the pressure on a system at equilibrium will shift the equilibrium towards the side with fewer moles of gas to relieve the stress. In this case, increasing pressure will favor the formation of ammonia, thus increasing its yield.

Question 19: A CARS passage on evolutionary biology states: 'Altruistic behavior in animals poses a challenge to naive interpretations of natural selection.' The word 'naive' as used here most nearly means:

• Morally pure and uncorrupted
• Childlike and emotionally sincere
• Empirically unverified
• Oversimplified and failing to account for complexity (Correct answer)

Correct answer: Oversimplified and failing to account for complexity

In academic prose, 'naive' applied to a theory means it oversimplifies and fails to capture the phenomenon's full complexity.

Question 20: Tom is a nationally recognized cellist who has recently accepted a scholarship to play in the orchestra at a prominent university. He was handed a package of sheet music during the summer to master by the fall semester. When it comes to his work, Tom is a perfectionist. He constantly compares himself to better musicians and is quite critical of himself when a section of one of his pieces is not mastered. Which of the following statements most accurately describes Tom?

• Low self-esteem, strong self-efficacy, external locus of control
• Low self-esteem, strong self-efficacy, internal locus of control (Correct answer)
• High self-esteem, strong self-efficacy, internal locus of control
• Low self-esteem, low self-efficacy, internal locus of control

Correct answer: Low self-esteem, strong self-efficacy, internal locus of control

Answer Explanation: (B) <br> It is important to remember for these questions that self-efficacy refers to a specific task, whereas self-esteem refers to the respect one has for themselves. Perfectionists, especially those who are known to be hard on themselves, often have an internal locus of control, blaming themselves for failures.

Question 21: A patient with damage to the right parietal lobe fails to eat food on the left side of their plate and shaves only the right side of their face. This is best described as:

• Prosopagnosia
• Anosognosia
• Visual field cut (hemianopia)
• Hemispatial neglect (Correct answer)

Correct answer: Hemispatial neglect

Hemispatial neglect, most commonly following right parietal damage, causes the patient to ignore the contralateral (left) side of space.

Question 22: Conformity experiments by Solomon Asch demonstrated that individuals often conform to group judgments even when those judgments are clearly incorrect. Which factor most increases conformity in these situations?

• Increased group size beyond three members (Correct answer)
• Anonymous response format
• High individual self-esteem
• Presence of at least one other dissenter

Correct answer: Increased group size beyond three members

Asch found that conformity increased with group size up to about 3–5 members, after which additional members provided diminishing increases in conformity pressure.

Question 23: A passage argues that mandatory voting would improve democratic outcomes. A critic responds that mandatory voting infringes on individual liberty. This objection is best described as:

• A straw man that misrepresents the author's proposal
• An appeal to authority citing constitutional scholars
• A counterargument based on a competing value not addressed by the author (Correct answer)
• An ad hominem attack on the author's political motives

Correct answer: A counterargument based on a competing value not addressed by the author

The critic introduces individual liberty as a value that competes with improved democratic outcomes, which the original argument had not weighed.

Question 24: According to signal detection theory, a radiologist who sets a very liberal criterion to catch all cancers, even at the cost of many false positives, is said to have:

• High specificity and low sensitivity
• High sensitivity and high d-prime
• A low threshold (beta) and many misses
• A lenient criterion (low beta) producing many false alarms (Correct answer)

Correct answer: A lenient criterion (low beta) producing many false alarms

A lenient (low beta) criterion means the observer says 'yes' (signal present) even when uncertain, resulting in many hits but also many false alarms.

Question 25: To survive, humans need a lot of help from the outside world. Without water, air, and other essentials, no one can survive. Thankfully, the human brain is programmed to seek out these resources as they become exhausted, preventing injury to the individual. However, the downside is that they can provide too much incentive and hence become a source of temptation. Which of the following statements best describes when a desire has turned into a temptation?

• A person pauses their show on TV in order to grab a blanket because they are cold.
• A marathon runner seeks out water after finishing a race.
• A person desiring to lose weight makes a late night snack to quell a craving.
• A free diver delays leaving the beach after a dive by a few minutes in order to regain their breath.

Answer Explanation: <br> Desires become temptations when they conflict with longer-term goals in order to satisfy short-term desires. A, C, and D are all desires that improve the individual’s long term outcome. Only A sacrifices the long-term goal for the short term.

Question 26: Which defense mechanism involves attributing one's own unacceptable thoughts or feelings to another person?

• Displacement
• Sublimation
• Reaction formation
• Projection (Correct answer)

Correct answer: Projection

Projection is a Freudian defense mechanism in which a person unconsciously attributes their own unwanted impulses or feelings to someone else.

Question 27: Phenylketonuria (PKU) is caused by a deficiency of which enzyme?

• Phenylalanine hydroxylase (Correct answer)
• Homogentisate dioxygenase
• Tyrosine hydroxylase
• Fumarylacetoacetase

Correct answer: Phenylalanine hydroxylase

PKU results from a loss-of-function mutation in phenylalanine hydroxylase, which normally converts phenylalanine to tyrosine; deficiency leads to phenylalanine accumulation and neurotoxic metabolite production.

Question 28: Acute Myeloid Leukemia (AML) is a type of cancer in which myeloid progenitor cells divide rapidly while maintaining their semi-stem cell status. Which of the following cell types would develop from this stem cell under normal circumstances?

• NK cell
• Platelet (Correct answer)
• Lymphoid progenitor
• T cell

Correct answer: Platelet

Myeloid progenitor cells are multipotent stem cells that differentiate into various blood cell types, including granulocytes (neutrophils, eosinophils, basophils), monocytes, erythrocytes (red blood cells), and megakaryocytes, which then produce platelets. NK cells and T cells, on the other hand, develop from lymphoid progenitor cells.

Question 29: In an SN2 reaction, the rate depends on which of the following?

• Only the concentration of the substrate
• Neither substrate nor nucleophile concentration
• Both the concentration of the substrate and nucleophile (Correct answer)
• Only the concentration of the nucleophile

Correct answer: Both the concentration of the substrate and nucleophile

SN2 is a bimolecular reaction with a concerted mechanism where the nucleophile attacks as the leaving group departs, so rate = k[substrate][nucleophile].

Question 30: The fovea centralis of the retina is specialized for high-acuity color vision and is densely packed with which photoreceptors?

• Equal rods and cones
• Rods only
• Cones only (Correct answer)
• Melanopsin-containing ganglion cells

Correct answer: Cones only

The fovea centralis contains only cones (no rods, no blood vessels) to maximize visual acuity and color discrimination in bright light.

Question 31: The World Systems Theory divides the world into three subcategories: core, periphery, and semi-periphery countries. Which of the following statements best describe countries in the semi-periphery?

• A diversified and developed economy. (Correct answer)
• Strong central government.
• An economy centralized around one natural resource.
• Small percentage of very high class individuals.

Correct answer: A diversified and developed economy.

Answer Explanation: (D) <br> This question, if encountered, would be difficult due to the fact that semi-periphery countries is actually a definition of a transition state both from core to periphery and in the opposite direction. Thus, there are no real strong defining characteristics, so elimination of answers will be needed. Strong central government more accurately defines core countries. Answers B and D describe periphery countries. Think of semi-periphery countries as those that do not have much global influence, but are not susceptible to it either. That should allow for the correct answer.

Question 32: The ability of the eukaryotic cell to compress coding sections when they are not being expressed is one of the numerous reasons why it can store so much information in its DNA. Which of the following processes will usually result in a decrease in gene expression when acting on DNA?

• Decrease in histone deacetyltransferase activity
• Increase in methylation activity (Correct answer)
• Increased histone acetyltransferase activity
• Increase in heterochromatin:euchromatin ratio

Correct answer: Increase in methylation activity

Answer Explanation: (A) <br> This is a straightforward question that assesses knowledge of modification of DNA segments. Although in the real world these methods are not exclusive to increasing or decreasing activity, for MCAT testing purposes, histone acetyltransferase (HAT) frees DNA from histone proteins for expression. Histone deacetyltransferase (HDAC) binds DNA more tightly to histone, creating more heterochromatin, which is not expressed. Methylation is an epigenetic modification that generally trends toward silencing gene expression.

Question 33: The blood-brain barrier is primarily formed by:

• Myelin sheaths surrounding capillaries
• Oligodendrocytes wrapping around blood vessels
• Microglia patrolling capillary walls
• Tight junctions between cerebral endothelial cells, supported by astrocytes (Correct answer)

Correct answer: Tight junctions between cerebral endothelial cells, supported by astrocytes

The blood-brain barrier consists of tight junctions between endothelial cells lining brain capillaries, with astrocytic endfeet providing additional support and regulation.

Question 34: Which of the following statements best describes the concept "HOW COULD SOMETHING ORIGINATE FROM IT'S OPPOSITE?" It's impossible for such a genesis to occur.”

• A deer and a mouse cannot be compared.
• Light cannot be considered good just because it gets rid of darkness. (Correct answer)
• Some people possess the knowledge of what is truth, and others never can.
• Two lies must have something in common.

Correct answer: Light cannot be considered good just because it gets rid of darkness.

The passage critiques metaphysicians for believing that 'things of the highest value must have a different origin, an origin of THEIR own' and cannot originate from their opposites (e.g., truth from error). This implies that metaphysicians would argue that good things possess an inherent goodness, not merely the absence of bad. Therefore, stating that 'Light cannot be considered good just because it gets rid of darkness' aligns with the metaphysicians' view that good has an independent, inherent origin, which the author then challenges.

Question 35: A young man working with a therapist to become more productive is sharing many of his ambitions as he grew up, as well as how he believes they have affected him. The therapist believes the young man's development is trapped in a stage that is reflected in his failure to maintain his residence clean, based on his discernment. What stage of psychosexual development would this young man be fixated on, according to Freud's theory?

• Phallic
• Genital
• Anal (Correct answer)
• Oral
• Latent

Correct answer: Anal

According to Freud's psychosexual stages, the anal stage (ages 1-3) focuses on bowel and bladder control. Fixation at this stage can lead to personality traits related to control, orderliness, or messiness. A failure to maintain a clean residence, as described, aligns with 'anal-expulsive' traits, indicating a fixation on this stage where the individual might be messy or rebellious.

Question 36: A passage about urban planning argues that mixed-use zoning reduces car dependency. The author then cites a study showing that residents of mixed-use neighborhoods walk more. This study functions in the argument as:

• An analogy drawn from a different policy context
• Empirical support for the causal link between zoning and behavior (Correct answer)
• A concession that weakens the author's main claim
• A counterexample that the author must explain away

Correct answer: Empirical support for the causal link between zoning and behavior

The study provides data showing behavioral change (more walking) that supports the author's claim that mixed-use zoning reduces car dependency.

Question 37: Which statement about enzyme kinetics is correct when substrate concentration is well above Km?

• Both B and C are correct (Correct answer)
• The reaction rate is proportional to substrate concentration
• The enzyme follows zero-order kinetics with respect to substrate
• The reaction rate is at Vmax and adding more substrate has little effect

Correct answer: Both B and C are correct

When [S] >> Km, the enzyme is saturated and operates at Vmax; since rate is constant regardless of [S], this is zero-order kinetics—so both B and C describe the same phenomenon.

Question 38: In a passage on medical ethics, the author distinguishes between 'therapeutic privilege'—withholding information from patients 'for their own good'—and patient autonomy. The author likely uses this distinction to argue that:

• Physicians should always disclose full medical information regardless of consequences
• Medical ethics has evolved to favor physician judgment over patient preferences
• Patient autonomy is a philosophical ideal impractical in clinical settings
• Therapeutic privilege is a paternalistic practice that compromises informed consent (Correct answer)

Correct answer: Therapeutic privilege is a paternalistic practice that compromises informed consent

Framing therapeutic privilege as withholding information while contrasting it with autonomy signals the author views the practice as paternalistic and ethically problematic.

Question 39: Which of the following describes the relationship between vapor pressure and temperature?

• Vapor pressure is independent of temperature
• Vapor pressure decreases linearly as temperature increases
• Vapor pressure decreases as temperature increases
• Vapor pressure increases as temperature increases (Correct answer)

Correct answer: Vapor pressure increases as temperature increases

As temperature increases, more molecules have sufficient kinetic energy to escape the liquid phase, increasing vapor pressure according to the Clausius-Clapeyron equation.

Question 40: Which of the following best describes the concept of 'stigma' as it relates to mental illness, according to sociological perspectives?

• The legal status of individuals with psychiatric diagnoses
• The patient's subjective experience of mental illness
• The neurobiological cause of psychiatric symptoms
• A mark of disgrace that sets a person apart and leads to social discrimination (Correct answer)

Correct answer: A mark of disgrace that sets a person apart and leads to social discrimination

Goffman defined stigma as a deeply discrediting attribute that reduces a person from a 'whole' person to a 'tainted' or 'discounted' one, resulting in social exclusion and discrimination.

Question 41: The author's position on "moneyed and proprietied interests" (paragraph 4) is best summarized as:

• indifferent.
• ambivalent
• negative. (Correct answer)

Correct answer: negative.

The author consistently portrays 'moneyed and propertied interests' negatively. They are described as 'unnerved' by popular uprisings and 'instrumental' in creating a 'more robust central government' that ultimately serves a 'nouveau aristocracy of corporate 'persons' and the rapacious class of executives.' This language clearly conveys a critical and disapproving stance towards their influence and actions.

Question 42: Which of the following molecules is most likely to exhibit resonance?

• C₆H₆ (benzene) (Correct answer)
• CH₄
• NaCl
• H₂O

Correct answer: C₆H₆ (benzene)

Benzene exhibits resonance because its delocalized π electrons can be represented by multiple equivalent Lewis structures with alternating single and double bonds.

Question 43: One of the clauses of the first amendment that has come to be considered as a part of the law is that no one can yell "fire!" In a congested space. Why would they put this restriction in place?

• It would be unlawful seizure of property.
• It endangers children.
• It infringes on the safety of others. (Correct answer)
• It allows the government to hold too much power.

Correct answer: It infringes on the safety of others.

While the First Amendment protects freedom of speech, this right is not absolute. Yelling 'fire!' in a crowded space when there is no actual fire is a classic example of speech that is restricted because it directly incites panic, creates disorder, and poses a significant risk to public safety, potentially leading to injuries or even fatalities. The restriction prioritizes the collective safety of individuals over an individual's right to reckless speech.

Question 44: George Herbert Mead's concept of the 'generalized other' refers to:

• A specific significant person whose opinions shape one's self-concept
• The collective identity formed through shared cultural practices
• The internalized sense of the expectations and attitudes of society as a whole (Correct answer)
• The imagined audience one considers when making decisions

Correct answer: The internalized sense of the expectations and attitudes of society as a whole

The generalized other represents an individual's awareness of societal norms and expectations, which are internalized through social interaction during development.

Question 45: The Circle of Willis is primarily supplied by which two sets of arteries?

• Vertebral and basilar arteries only
• Internal carotid and external carotid arteries
• External carotid and vertebral arteries
• Internal carotid arteries and vertebrobasilar system (Correct answer)

Correct answer: Internal carotid arteries and vertebrobasilar system

The Circle of Willis receives blood from the paired internal carotid arteries anteriorly and the vertebrobasilar system posteriorly.

Question 46: A physician notices that patients from collectivist cultures tend to describe illness in terms of family and community impact rather than personal symptoms. This reflects which concept?

• Acculturation
• Ethnocentrism
• Cultural competence
• Individualism versus collectivism (Correct answer)

Correct answer: Individualism versus collectivism

Individualism-collectivism is a cultural dimension describing the extent to which people define themselves through personal versus group identity, influencing health perceptions and communication.

Question 47: A rare genetic disease with X-linked recessive transmission is discovered in a newborn's genetic test. Which of the following claims about this disorder's pedigree is most likely correct?

• All descendants on the maternal side will have the disorder.
• There will be equal distribution of males and females affected.
• All daughters of an affected male will be affected. (Correct answer)
• Females will be approximately twice as affected as males in this family.

Correct answer: All daughters of an affected male will be affected.

For an X-linked recessive disorder, an affected male (X^rY) passes his X chromosome, which carries the recessive allele (X^r), to all of his daughters. Therefore, all daughters will inherit this recessive allele. While they may not express the phenotype if they are heterozygous carriers (X^rX^N), they are genetically 'affected' in the sense of carrying the disease allele.

Question 48: The 'sick role' as described by Talcott Parsons includes the expectation that a sick person will:

• Seek professional medical care and try to get well (Correct answer)
• Accept permanent disability as a new social identity
• Be exempt from all social obligations indefinitely
• Rely on family members rather than physicians for care

Correct answer: Seek professional medical care and try to get well

Parsons' sick role grants the ill person exemption from normal duties but requires them to seek competent medical help and cooperate with treatment.

Question 49: Who is the Sphinx that the writer is referring to in this passage?

• A representative of those that answer questions.
• The spirit of a lie.
• A representative of those that ask questions. (Correct answer)
• A statue of stoic nature.

Correct answer: A representative of those that ask questions.

The passage explicitly states, 'That this Sphinx teaches us at last to ask questions ourselves? WHO is it really that puts questions to us here?'. This directly links the Sphinx to the act of posing questions. In Greek mythology, the Sphinx is known for asking riddles, further solidifying its role as a representative of those who ask challenging questions.

Question 50: A solution is prepared by dissolving 0.1 mol NaCl in 1 kg of water. What is the expected freezing point? (Kf water = 1.86°C/m)

• –0.186°C
• –0.744°C
• –0.372°C (Correct answer)
• –0.093°C

Correct answer: –0.372°C

NaCl dissociates into 2 ions, so i = 2; ΔTf = iKfm = 2 × 1.86 × 0.1 = 0.372°C depression.

Question 51: Which of the following is an example of negative reinforcement?

• Taking ibuprofen to relieve a headache, increasing the likelihood of future ibuprofen use (Correct answer)
• Being praised for completing homework
• Receiving a trophy for winning a competition
• Getting a speeding ticket to reduce fast driving

Correct answer: Taking ibuprofen to relieve a headache, increasing the likelihood of future ibuprofen use

Negative reinforcement involves removing an aversive stimulus (pain) following a behavior (taking ibuprofen), which increases the probability of that behavior recurring.

Question 52: Which theory of emotion proposes that physiological arousal and the cognitive label applied to that arousal together produce the emotional experience?

• Schachter-Singer two-factor theory (Correct answer)
• Cannon-Bard theory
• Lazarus cognitive appraisal theory
• James-Lange theory

Correct answer: Schachter-Singer two-factor theory

The Schachter-Singer two-factor theory holds that emotion = physiological arousal + cognitive label assigned to explain that arousal.

Question 53: The Stroop effect, where naming ink color is slower when the word spells a different color, demonstrates which psychological phenomenon?

• Inattentional blindness
• Perceptual set
• Change blindness
• Selective attention and cognitive interference (Correct answer)

Correct answer: Selective attention and cognitive interference

The Stroop effect illustrates that automatic reading of words interferes with the controlled process of naming ink colors, demonstrating cognitive interference.

Question 54: Sergey Levin, Levin's half-brother, is working with a philosophy professor on the real-world boundary between psychology and physiology. Which of the following statements would support the professor's point of view?

• An animal with the sensory pathways removed from their spinal cord ceases to display any interaction with the environment. (Correct answer)
• Scientists discover a brain area that generates consciousness.
• Coma patients show a lack of response to any outside influence.
• Blind individuals have visions of the real world that they could not have derived from memories.

Correct answer: An animal with the sensory pathways removed from their spinal cord ceases to display any interaction with the environment.

The professor's argument hinges on the idea that 'perception is based on sensation.' If an animal with its sensory pathways removed (a physiological intervention) ceases to interact with its environment (a psychological/behavioral outcome), it directly supports the professor's view that physiological sensations are fundamental for psychological phenomena like perception and interaction. This demonstrates a clear link between the physical and the mental as he describes.

Question 55: Which of the following is an example of 'secondary deviance' as defined by Edwin Lemert?

• A teenager who experiments with drugs but stops after peers discourage the behavior
• A person who commits a minor traffic violation but does not consider themselves deviant
• A person labeled as a criminal who reorganizes their identity around that label and commits more crimes (Correct answer)
• A politician who accepts a bribe but is never caught or publicly identified

Correct answer: A person labeled as a criminal who reorganizes their identity around that label and commits more crimes

Secondary deviance occurs when a person internalizes a deviant label and builds their identity around it, leading to continued deviant behavior.

Question 56: In CARS, the primary purpose of re-reading the last sentence of a passage paragraph is typically to:

• Memorize specific data points for later retrieval
• Identify the transitional phrase that connects to the next paragraph
• Locate the topic sentence if it was missed on the first read
• Confirm the paragraph's main point and how it connects to the overall argument (Correct answer)

Correct answer: Confirm the paragraph's main point and how it connects to the overall argument

Concluding sentences often synthesize the paragraph's argument and signal its relationship to the passage's broader thesis, making them valuable for comprehension.

Question 57: Which scientific method step follows hypothesis formation?

• Experimentation and testing (Correct answer)
• Observation
• Conclusion
• Publication

Correct answer: Experimentation and testing

After forming a hypothesis, the next step is designing and conducting experiments to test whether the hypothesis is supported by evidence.

Question 58: A passage argues that narrative medicine—training physicians to analyze literary texts—improves patient care. Which of the following would most weaken this argument?

• A controlled study shows no measurable difference in patient outcomes between physicians trained in narrative medicine and those who were not (Correct answer)
• Literary scholars have long argued that reading fiction builds empathy
• Medical schools with narrative medicine curricula report higher student satisfaction
• Some physicians find narrative medicine courses interesting and personally enriching

Correct answer: A controlled study shows no measurable difference in patient outcomes between physicians trained in narrative medicine and those who were not

A controlled study showing no difference in patient outcomes directly undermines the core claim that narrative medicine improves patient care.

Question 59: Which factor is most important when evaluating the quality of scientific research for MCAT?

• Reputation of the authors
• Length of the study report
• Methodology, sample size, and peer review status (Correct answer)
• Number of references cited

Correct answer: Methodology, sample size, and peer review status

Research quality is best evaluated by examining the methodology, adequacy of sample size, and whether the study has undergone peer review.

Question 60: Karl Marx proposed the Conflict Theory, which is founded on the idea that power determines how people interact in society. Which of the following assertions is the most accurate representation of the Conflict Theory?

• People act based on their past experiences to view society through a lens.
• Institutions will only change when they have to in order to meet demand and to the minimum necessary.
• Society agrees on the specific value of an item that otherwise would not have intrinsic worth.
• Society consists of one group of people who desire change and one group of people who are content with status quo. (Correct answer)

Correct answer: Society consists of one group of people who desire change and one group of people who are content with status quo.

Answer Explanation: (C) <br> C is the answer that most closely correlate to the Marx theory. In this theory, the group that is content with the status quo is the group in power. Answer B correlates closer to Functionalism, which states that institutions and the population exist in a balance. Answer D describes social constructionism. Answer A is consistent with symbolic interactionism, which at its heart states that the world is created by people interacting with it.

Question 61: Which statement concerning fat-soluble vitamins is correct? <br> I. Vitamin D protects against cancer because it is a biological antioxidant. <br> II. Vitamin K is necessary for the posttranslational introduction of calcium-binding sites. <br> III. Vitamin A is metabolized to retinal, which is important for sight. <br> IV. Vitamin E is important for calcium regulation.

• I only
• II and III only (Correct answer)
• II and IV only
• I and IV only

Correct answer: II and III only

Vitamin K is essential for the post-translational modification of clotting factors, specifically the carboxylation of glutamate residues, which creates calcium-binding sites necessary for coagulation. Vitamin A is metabolized to retinal, a component of rhodopsin, which is crucial for vision. Therefore, statements II and III are correct.

Question 62: During REM sleep, the brain exhibits which of the following EEG patterns?

• Theta waves only
• Sleep spindles and K-complexes
• High-amplitude, low-frequency delta waves
• Low-amplitude, high-frequency waves similar to waking (Correct answer)

Correct answer: Low-amplitude, high-frequency waves similar to waking

REM sleep shows desynchronized, low-amplitude, high-frequency EEG activity resembling an awake brain, along with rapid eye movements and muscle atonia.

Question 63: At constant temperature, if the pressure of an ideal gas is tripled, the volume becomes:

• One-third of the original (Correct answer)
• Nine times the original
• Three times the original
• One-ninth of the original

Correct answer: One-third of the original

Boyle's Law: P₁V₁ = P₂V₂; tripling pressure reduces volume to one-third at constant temperature.

Question 64: Which sensory system is primarily responsible for detecting the body's position and movement in space?

• Vestibular system
• Proprioceptive system (Correct answer)
• Olfactory system
• Somatosensory system

Correct answer: Proprioceptive system

Proprioception involves sensory receptors in muscles, tendons, and joints that signal body position and movement to the central nervous system.

Question 65: Which of the following professor character developments do you think is most likely to happen as the tale progresses?

• He believes non-university graduates to be inferior. (Correct answer)
• He is a world-renowned neurosurgeon.
• He is a devout Christian.
• He is a volunteer at a homeless shelter.

Correct answer: He believes non-university graduates to be inferior.

The professor's reaction to Levin's question is highly dismissive and condescending. He looks at Levin 'in annoyance, and, as it were, mental suffering at the interruption,' and mentally labels him 'more like a bargeman than a philosopher.' This strong negative judgment of someone outside his academic sphere suggests an elitist attitude and a belief in the inferiority of non-university graduates.

Question 66: What would be the most crucial thing for a person to do after using a sauna, according to the article?

• Exercise.
• Replenish fluids with filtered water. (Correct answer)
• Shower in cold water.
• Eat a meal.

Correct answer: Replenish fluids with filtered water.

Saunas induce significant sweating, which leads to a substantial loss of bodily fluids. The most crucial action after using a sauna is to replenish these lost fluids to prevent dehydration and maintain proper bodily function. Drinking filtered water effectively rehydrates the body and restores electrolyte balance.

Question 67: According to the James-Lange theory of emotion, emotions arise from:

• Cognitive appraisal of a situation followed by physiological arousal
• Awareness of one's own physiological responses to stimuli (Correct answer)
• Simultaneous physiological arousal and emotional experience
• Subcortical brain activation independent of conscious awareness

Correct answer: Awareness of one's own physiological responses to stimuli

The James-Lange theory holds that we experience emotion by perceiving our bodily physiological responses (e.g., 'I am afraid because I am trembling').

Question 68: A CARS passage describes a philosopher who claims that free will is incompatible with determinism. Which of the following, if true, would most directly strengthen this philosopher's position?

• Determinism is accepted by most contemporary physicists
• Neuroscience shows that brain activity preceding a decision occurs before conscious awareness of the choice (Correct answer)
• Ancient philosophers also debated the nature of free will
• Many people report subjectively feeling that they make free choices

Correct answer: Neuroscience shows that brain activity preceding a decision occurs before conscious awareness of the choice

If unconscious brain activity precedes and drives decisions, conscious choice appears illusory, directly supporting the claim that determinism undermines free will.

Question 69: Which reagent would best convert a carboxylic acid to a primary amine via a Curtius-type rearrangement?

• NaBH4
• LiAlH4
• DPPA (diphenylphosphoryl azide) followed by heat and hydrolysis (Correct answer)
• SOCl2 then NH3

Correct answer: DPPA (diphenylphosphoryl azide) followed by heat and hydrolysis

DPPA converts carboxylic acids to acyl azides, which rearrange on heating (Curtius rearrangement) to isocyanates; hydrolysis then gives primary amines.

Question 70: A researcher finds that as ice cream sales increase, drowning rates also increase. The most likely explanation is:

• The correlation proves a causal relationship between ice cream and drowning
• Ice cream consumption causes dehydration, increasing drowning risk
• Drowning victims often had ice cream beforehand
• Both variables increase in summer, making temperature a confounding variable (Correct answer)

Correct answer: Both variables increase in summer, making temperature a confounding variable

This is a classic example of a spurious correlation driven by a confounding variable (season/temperature) that independently increases both ice cream consumption and swimming-related drowning.

Question 71: A photon has a wavelength of 400 nm. What is its energy? (h = 6.63 × 10⁻³⁴ J·s, c = 3 × 10⁸ m/s)

• 4.97 × 10⁻¹⁹ J (Correct answer)
• 9.94 × 10⁻¹⁹ J
• 3.31 × 10⁻¹⁹ J
• 1.66 × 10⁻¹⁹ J

Correct answer: 4.97 × 10⁻¹⁹ J

E = hc/λ = (6.63 × 10⁻³⁴ × 3 × 10⁸) / (400 × 10⁻⁹) ≈ 4.97 × 10⁻¹⁹ J.

Question 72: Which ligament connects the liver to the anterior abdominal wall and contains the ligamentum teres hepatis?

• Hepatoduodenal ligament
• Falciform ligament (Correct answer)
• Gastrohepatic ligament
• Coronary ligament

Correct answer: Falciform ligament

The falciform ligament attaches the liver to the anterior abdominal wall and contains the ligamentum teres hepatis (obliterated umbilical vein).

Question 73: A reaction has ΔH = –50 kJ/mol and ΔS = –100 J/(mol·K). At what temperature does this reaction become non-spontaneous?

• Below 500 K
• Above 500 K (Correct answer)
• Below 250 K
• Above 250 K

Correct answer: Above 500 K

ΔG = ΔH – TΔS; spontaneous when ΔG < 0. Since both ΔH and ΔS are negative, ΔG becomes positive (non-spontaneous) when T > ΔH/ΔS = 50,000/100 = 500 K.

Question 74: In an E2 elimination reaction, what is the required geometric relationship between the leaving group and the beta hydrogen?

• Anti-periplanar (180°) (Correct answer)
• Syn-periplanar (0°)
• Eclipsed (120°)
• Gauche (60°)

Correct answer: Anti-periplanar (180°)

E2 requires an anti-periplanar arrangement (180°) so that the breaking bonds can align with the forming pi bond in a concerted step.

Question 75: A CARS question asks what the author would most likely agree with. The passage argues that economic growth metrics ignore environmental costs. The best answer would be:

• Environmental protection always takes precedence over economic development
• International bodies should set binding emissions limits on all nations
• Standard economic metrics are inadequate because they exclude ecological damage (Correct answer)
• GDP growth should be pursued even when it harms ecosystems

Correct answer: Standard economic metrics are inadequate because they exclude ecological damage

The author's central point is about the inadequacy of existing growth metrics, not a sweeping prioritization of environment over economy or a specific policy mandate.

Question 76: The Bill of Rights was written specifically to defend individual rights, as stated in the text. Which of the following is NOT an example of a situation for which this statute aimed to provide individual liberties?

• A protestor gathering people outside of city hall.
• A Jehovah’s Witness practicing their right to refuse blood donation.
• A national religion allowing people to practice across states. (Correct answer)
• A police officer requiring a warrant before searching a car for drugs.

Correct answer: A national religion allowing people to practice across states.

The passage explicitly states that 'the Constitution prohibited the establishment of an official religion at the national level.' The First Amendment guarantees freedom *of* religion and prevents the government from establishing a national religion. Therefore, a national religion, even one allowing practice across states, is precisely what the Bill of Rights aimed to prevent, not provide for as an individual liberty.

Question 77: The inguinal ligament is formed by the lower edge of which abdominal muscle's aponeurosis?

• Internal oblique
• Rectus abdominis
• Transversus abdominis
• External oblique (Correct answer)

Correct answer: External oblique

The inguinal ligament is the folded-under lower edge of the external oblique aponeurosis, running from the ASIS to the pubic tubercle.

Question 78: A passage describes how a 19th-century novelist embedded political critique within romantic plots to avoid censorship. This strategy is best described as:

• Allegorical writing that encodes subversive meaning in surface-level narrative (Correct answer)
• Naturalistic writing that depicts social conditions without authorial judgment
• Propagandistic writing that directly promotes a political agenda
• Formalist writing that subordinates content to aesthetic form

Correct answer: Allegorical writing that encodes subversive meaning in surface-level narrative

Using romance as a surface layer to convey hidden political meaning is the defining feature of allegory, a mode where narrative elements stand for ideas beyond themselves.

Question 79: According to some researchers, the US federal government did less to safeguard residents whose homes were taken away in false foreclosures during the 2007–2008 financial crisis than to defend the banks that engaged in this illegal action. What effect does this have on the passage if it's true?

• It challenges the author's central argument.
• It weakens the assertion that the people have exchanged one master for another.
• It supports the author's central argument. (Correct answer)
• It strengthens the claim that the wealthy shaped the creation of the US Constitution.

Correct answer: It supports the author's central argument.

The author's central argument, especially in the final paragraph, is that the federal government has become a 'bureaucratic behemoth, ultimately in thrall to the nouveau aristocracy of corporate 'persons' and the rapacious class of executives.' The hypothetical scenario, where the government protects banks over citizens in foreclosures, directly supports this claim that the government prioritizes powerful corporate interests over the well-being of the general populace, thus strengthening the author's main thesis.

Question 80: A student runs a reaction of 1-bromopropane with NaCN in DMSO. What is the major product?

• Propyne
• Propanol
• Propanamine
• Propanenitrile (butanenitrile) (Correct answer)

Correct answer: Propanenitrile (butanenitrile)

CN⁻ is a strong nucleophile that attacks the primary alkyl bromide via SN2, forming butanenitrile (one carbon longer than the substrate).

Question 81: A passage argues that the peer review system in science, while imperfect, remains the best available mechanism for quality control. The author's attitude toward peer review is best described as:

• Neutral and descriptive without taking a position
• Qualified endorsement that acknowledges flaws while defending its utility (Correct answer)
• Skeptical and calling for its replacement with open review
• Uncritically enthusiastic and without reservation

Correct answer: Qualified endorsement that acknowledges flaws while defending its utility

Phrases like 'while imperfect, remains the best' signal qualified endorsement: the author sees flaws but still defends the system's value.

Question 82: Which of the following is an example of a negative reinforcement schedule?

• Giving a child candy for completing homework
• Removing a loud alarm when a driver buckles their seatbelt (Correct answer)
• Sending a child to time-out for misbehavior
• Taking away TV privileges for poor grades

Correct answer: Removing a loud alarm when a driver buckles their seatbelt

Negative reinforcement increases a behavior by removing an aversive stimulus; buckling the seatbelt (behavior) is reinforced by stopping the alarm (removal of aversive stimulus).

Question 83: Which metabolic pathway is uniquely active in the absorptive state to convert excess glucose to fatty acids?

• Gluconeogenesis
• Beta-oxidation
• Glycogenolysis
• De novo lipogenesis (Correct answer)

Correct answer: De novo lipogenesis

De novo lipogenesis converts excess acetyl-CoA (from glucose catabolism) into fatty acids during the absorptive state when insulin is high.

Question 84: New York City has a population of nearly 7 million people from all walks of life. Although the city has its own distinct qualities, there are various smaller districts, mainly clusters of people of the same nationality who follow the customs of their previous home country. For example, greeting individuals with cheek kisses is still usual in Little Italy, a small village within the city. What kind of phenomenon is this an example of?

• Culture lag
• Microculture
• Counterculture
• Subculture (Correct answer)

Correct answer: Subculture

Answer Explanation: (B) <br> The definitions of these terms are very close together, which make their distinctions important to know to answer questions. In order for customs to be considered counterculture, they must go against norms of the larger area within which they are encapsulated. For a custom to be considered a microculture, it must not be long enough to exist throughout a lifetime. Culture lag can commonly be mixed with retained customs, but it is important to know that lag refers to practices that are outdated by the newer form. Cheek kisses do not go against any of New York’s traditions, so it would just fall under subculture.

Question 85: Maple syrup urine disease results from deficiency of which enzyme complex?

• Branched-chain alpha-keto acid dehydrogenase (Correct answer)
• Propionyl-CoA carboxylase
• Pyruvate dehydrogenase
• Alpha-ketoglutarate dehydrogenase

Correct answer: Branched-chain alpha-keto acid dehydrogenase

Branched-chain alpha-keto acid dehydrogenase deficiency leads to accumulation of leucine, isoleucine, and valine metabolites, causing characteristic sweet-smelling urine.

Question 86: In the United States, the Industrial Revolution saw a major drive toward urbanization for living areas. Which of the following is NOT a benefit to people who relocate from rural to urban regions?

• Job opportunities
• Decrease in gentrification (Correct answer)
• Improved utilities
• Increased transportation

Correct answer: Decrease in gentrification

Answer Explanation: (C) <br> Opportunities and, conversely, challenges of urbanization have not drastically change since the initial explosion in the U.S. in the early 1900s. Infrastructure is widely available in cities, which leads to benefits outlined in the first three answers. However, a process called reurbanization, which is the second wave of urbanization that follows the first decline of a city, usually targets old areas where people who do not have the resources to move out of the city get pushed out of. This leads to substantial gentrification along these borders.

Question 87: A CARS passage on classical music argues that its declining audience reflects cultural elitism rather than musical quality. An inference that follows from this argument is that:

• Musical quality is impossible to evaluate objectively
• Classical musicians should adopt popular music techniques to survive
• Classical music is objectively superior to popular music
• Widening access to classical music venues could expand its audience (Correct answer)

Correct answer: Widening access to classical music venues could expand its audience

If elitist access barriers rather than quality explain the decline, removing those barriers would logically be expected to grow the audience.

Question 88: A passage attributes the decline of print journalism primarily to the internet's disruption of advertising revenue. A critic argues that declining readership preceded internet adoption. This critique:

• Strengthens the author's argument by providing additional context
• Accepts the author's causal claim but proposes a different solution
• Challenges the author's timeline, suggesting the cause may precede the proposed cause (Correct answer)
• Introduces an irrelevant factor that the author already acknowledged

Correct answer: Challenges the author's timeline, suggesting the cause may precede the proposed cause

If readership fell before the internet became widespread, the internet cannot be the primary cause of print journalism's decline, undermining the author's causal sequence.

Question 89: Why does the text declare the Bill of Rights to be "ambiguous?"

• Applying these rights to territories of the U.S. is very uncertain.
• There are definitions lacking that create controversy. (Correct answer)
• The idea of an individual is not well defined.
• The rights can be supplanted in times of national emergency.

Correct answer: There are definitions lacking that create controversy.

The text states, 'the ambiguous wording of many of its provisions—such as the Second Amendment’s right 'to keep and bear arms' and the Eighth Amendment’s prohibition of 'cruel and unusual punishments'—has been a source of constitutional controversy and intense political debate.' This clearly indicates that the lack of precise definitions for key terms within these amendments leads to ongoing disputes and makes their application uncertain, hence the ambiguity.

Question 90: A pharmaceutical company disproportionately conducts clinical trials in wealthy nations and then markets drugs to low-income countries without local testing. This illustrates:

• Global health inequality reinforced by differential access to research resources (Correct answer)
• Publication bias in scientific literature
• Ethical violations under the Declaration of Helsinki
• Conflict of interest in research design

Correct answer: Global health inequality reinforced by differential access to research resources

This practice reflects how global structures of inequality shape which populations benefit from medical research and which are treated as secondary markets.

Question 91: A scientist conducting research on hearing aids fitted 30 mice with the newest technology after they were genetically changed to lose their hearing and were tested to press a lever when they heard a bell. This was set to a range of power levels. Twenty mice pressed the lever at 80% power. 15 mice pressed the lever at 70 percent power. Ten mice pressed the lever with 60 percent power. Which of the following is the absolute threshold for hearing the decibels produced by the bell?

• 60%
• 80%
• 70% (Correct answer)
• Not enough information given.

Correct answer: 70%

Answer Explanation: (B) <br> This question rests exclusively on the knowledge of what defines the absolute threshold of sensation, which is when 50% of the time, the stimulus is recorded. In this question, with the information given, that would mean the power setting that would allow 15 mice to observe the sound of the bell. Below this would be subliminal.

Question 92: An object of mass m traveling at velocity v collides with an identical stationary object and the two stick together. What is their combined velocity?

• v/4
• v/2 (Correct answer)
• v
• 2v

Correct answer: v/2

By conservation of momentum, mv = 2m·v_f, so v_f = v/2.

Question 93: The epidemiological finding that social support is associated with better health outcomes is best explained by which sociological concept?

• Anomie leading to risk-taking behavior in isolated individuals
• Social capital and its role in buffering stress and increasing access to health resources (Correct answer)
• Medicalization of loneliness as a diagnosable condition
• The sick role and its requirement for social validation of illness

Correct answer: Social capital and its role in buffering stress and increasing access to health resources

Social capital, particularly bonding ties within supportive networks, provides psychological buffering against stress and practical help that improves health outcomes.

Question 94: A therapist uses systematic desensitization to treat a patient's spider phobia. The core mechanism of therapeutic change in this technique is:

• Flooding the patient with fear to exhaust the anxiety response
• Pairing relaxation with graduated exposure to extinguish the conditioned fear response (Correct answer)
• Operant reinforcement for approach behavior toward spiders
• Cognitive restructuring of irrational beliefs about spiders

Correct answer: Pairing relaxation with graduated exposure to extinguish the conditioned fear response

Systematic desensitization uses counter-conditioning by pairing a relaxation response with progressively more feared stimuli to extinguish the conditioned anxiety.

Question 95: Samantha is a college student who is working with her therapist to improve her self-esteem and self-efficacy. After three months of counseling, she has observed a significant improvement in her capacity to handle problems. Which of the following is NOT an approach her therapist would recommend for increasing her sense of self-efficacy?

• Seek positive feedback from friends.
• Avoid potential pitfalls by withholding from tasks she is not proficient in. (Correct answer)
• Find others her age and ability who excel at tasks she is interested in.
• Put in daily practice on the tasks she wishes to improve on.

Correct answer: Avoid potential pitfalls by withholding from tasks she is not proficient in.

Answer Explanation: (A) <br> Self-efficacy correlates most closely to a person’s sense of ability within a specific set of tasks. The four known ways to improve self-efficacy are mastery of experience, social modeling, social persuasion, and psychological responses. Avoiding tasks, however, is an indication of weak self-efficacy.

Question 96: In a CARS passage, the author writes: 'While critics decry the rise of social media, they fail to acknowledge its democratizing potential.' The word 'democratizing' as used here most nearly means:

• Promoting political elections
• Enforcing equal time for opposing viewpoints
• Reducing economic inequality
• Widening access to platforms for public expression (Correct answer)

Correct answer: Widening access to platforms for public expression

In the context of social media criticism, 'democratizing' refers to lowering barriers so more people can participate in public discourse.

Question 97: The rational choice theory is founded on the idea that acts are chosen based on the individual's benefit. Completeness, transitivity, and variable independence are the three essential axioms of rational theory. What kind of system is most appropriately described?

• Oligarchic
• Matriarchal
• Hierarchical (Correct answer)
• Patriarchal

Correct answer: Hierarchical

Answer Explanation: (B) <br> The key to answering this question is to know the definitions of the components of rational choice theory. Completeness in this context means that actions can be ranked according to each other. Transitivity defines the fact that if an action is considered higher rank than a second, and a third action is considered lesser than the second, that the first action can be considered higher than the third. The final component, independence, defines the fact that additional variables do not change ranking. B, C, and D all place benefit to some individuals over others that would not change depending on the individual, which is not in concordance with this theory.

Question 98: Which of the following statements is the author most likely to agree with based on the article?

• Patients on a diet would benefit from sauna use.
• Salt restriction would be equal to sauna use for hypertensive patients.
• Heart surgery patients who cannot run on treadmills may benefit from sauna use. (Correct answer)
• Patients with skin conditions may be cured with sauna use.

Correct answer: Heart surgery patients who cannot run on treadmills may benefit from sauna use.

The article explicitly states that 'sauna use has been proposed as an alternative to exercise for people who are unable to engage in physical activity due to chronic disease or physical limitations.' Heart surgery patients often have physical limitations that prevent them from performing strenuous activities like running on a treadmill. Therefore, the author would likely agree that sauna use could be a beneficial alternative for such individuals to gain exercise-like benefits.

Question 99: According to Hardy-Weinberg equilibrium, which condition must be met for a population to remain in equilibrium?

• Natural selection is actively occurring
• Population size is very small
• Allele and genotype frequencies remain constant across generations (Correct answer)
• Mating is nonrandom within the population

Correct answer: Allele and genotype frequencies remain constant across generations

Hardy-Weinberg equilibrium describes a state where allele and genotype frequencies remain constant generation after generation in the absence of evolutionary forces.

Question 100: Which scientific method step follows hypothesis formation?

• Conclusion
• Publication
• Observation
• Experimentation and testing (Correct answer)

Correct answer: Experimentation and testing

After forming a hypothesis, the next step is designing and conducting experiments to test whether the hypothesis is supported by evidence.

Question 101: During a timed CARS section, a student reads a passage but finds the main argument unclear after the first read-through. The most effective strategy is to:

• Re-read the entire passage from the beginning before attempting any questions
• Answer all questions based on general knowledge of the topic
• Use the questions themselves to identify what aspects of the passage are most important, then re-read targeted sections (Correct answer)
• Skip all questions for that passage and return at the end of the section

Correct answer: Use the questions themselves to identify what aspects of the passage are most important, then re-read targeted sections

CARS questions highlight what the test-makers consider most important; using them to guide targeted re-reading is more efficient than a full second read under time pressure.

Question 102: A scientist uses mouse models to study the response of blood hormones to high levels of glucose in the body and discovers a previously unknown hormone. This hormone is located both inside and outside of cells when performing its function, increases the amount of nucleic acid in the cell when operating, and is formed from a structure having four hydroxycarbon rings, according to his data. Which hormone will this most likely be classified as?

• Steroid (Correct answer)
• Amino acid
• Peptide
• Enzymatic

Correct answer: Steroid

Steroid hormones are lipid-soluble, allowing them to easily cross cell membranes and function both inside and outside cells. Their characteristic structure is based on a four-ring carbon skeleton. Steroids often act as transcription factors, binding to intracellular receptors and influencing gene expression, which leads to an increase in nucleic acid (RNA) synthesis.

Question 103: Which of the following best describes a sigma (σ) bond?

• A bond formed by the side-to-side overlap of p orbitals
• A bond found only in aromatic compounds
• A bond that allows free rotation to be restricted
• A bond formed by the head-on overlap of orbitals along the internuclear axis (Correct answer)

Correct answer: A bond formed by the head-on overlap of orbitals along the internuclear axis

A sigma bond forms from head-on (end-to-end) overlap of orbitals along the internuclear axis and allows free rotation; all single bonds are sigma bonds.

Question 104: The lac repressor protein is inactivated (prevented from binding the operator) when it binds to:

• Cyclic AMP (cAMP)
• Allolactose (a metabolite of lactose) (Correct answer)
• The operator DNA sequence directly
• RNA polymerase sigma factor

Correct answer: Allolactose (a metabolite of lactose)

Allolactose, produced from lactose by beta-galactosidase, acts as the true inducer by binding to the lac repressor and causing a conformational change that prevents operator binding.

Question 105: Which of the following pairs are diastereomers?

• Two molecules with the same molecular formula but different connectivity
• Stereoisomers that are not mirror images of each other (Correct answer)
• Two molecules that are mirror images and non-superimposable
• Molecules that differ only by rotation around a single bond

Correct answer: Stereoisomers that are not mirror images of each other

Diastereomers are stereoisomers with the same connectivity but different spatial arrangements that are NOT mirror images of each other, such as cis-trans isomers or epimers.

Question 106: Which fontanelle is the last to close and is located at the junction of the sagittal and coronal sutures?

• Mastoid fontanelle
• Anterior (frontal) fontanelle (Correct answer)
• Sphenoidal fontanelle
• Posterior (occipital) fontanelle

Correct answer: Anterior (frontal) fontanelle

The anterior fontanelle, located at the bregma (junction of sagittal and coronal sutures), is the largest and last to close, typically around 18-24 months.

Question 107: Which neurotransmitter is primarily depleted in Parkinson's disease, leading to motor deficits?

• Dopamine (Correct answer)
• GABA
• Serotonin
• Acetylcholine

Correct answer: Dopamine

Parkinson's disease results from loss of dopaminergic neurons in the substantia nigra, disrupting the motor control circuit.

Question 108: The pterygoid plexus of veins drains into which vessel?

• Internal jugular vein
• External jugular vein
• Maxillary vein (Correct answer)
• Facial vein

Correct answer: Maxillary vein

The pterygoid plexus drains primarily into the maxillary vein, which joins the superficial temporal vein to form the retromandibular vein.

Question 109: A mutation that converts a codon from UAU (Tyr) to UAA results in what type of mutation?

• Silent mutation
• Frameshift mutation
• Missense mutation
• Nonsense mutation (Correct answer)

Correct answer: Nonsense mutation

UAA is a stop codon; converting an amino acid codon to a stop codon creates a nonsense mutation that causes premature termination of translation.

Question 110: During pre-mRNA splicing, which sequences are removed to produce mature mRNA?

• The 5' methylguanosine cap
• The 3' poly-A tail
• Exons (expressed sequences)
• Introns (intervening sequences) (Correct answer)

Correct answer: Introns (intervening sequences)

Introns are non-coding intervening sequences excised from pre-mRNA by the spliceosome; the remaining exons are ligated together to form the mature mRNA that is translated.

Question 111: What is the role of helicase during DNA replication?

• Joins Okazaki fragments
• Unwinds the double helix by breaking hydrogen bonds (Correct answer)
• Adds RNA primers
• Synthesizes new DNA strands

Correct answer: Unwinds the double helix by breaking hydrogen bonds

Helicase unwinds the DNA double helix by breaking the hydrogen bonds between complementary base pairs at the replication fork.

Question 112: The hepatopancreatic ampulla (of Vater) opens into which part of the duodenum?

• Second part (descending) (Correct answer)
• Fourth part (ascending)
• First part (superior)
• Third part (horizontal)

Correct answer: Second part (descending)

The ampulla of Vater opens on the major duodenal papilla in the second (descending) part of the duodenum.

Question 113: Which of the following correctly describes the Hardy-Weinberg principle?

• In a large random-mating population without evolutionary forces, allele frequencies remain constant (Correct answer)
• Natural selection always drives populations toward Hardy-Weinberg equilibrium
• Genetic drift is negligible only in small populations
• Allele frequencies change predictably with each generation

Correct answer: In a large random-mating population without evolutionary forces, allele frequencies remain constant

Hardy-Weinberg states that in an idealized population (large, random mating, no mutation/migration/selection/drift), allele and genotype frequencies remain constant across generations.

Question 114: A passage presents a sociologist's view that crime rates reflect structural inequality rather than individual moral failing. The author's rhetorical goal in emphasizing 'structural' is most likely to:

• Claim that poverty always leads to criminal behavior
• Exonerate individuals from all personal responsibility for criminal acts
• Shift analytical focus from individual behavior to systemic social conditions (Correct answer)
• Argue that law enforcement budgets should be reduced

Correct answer: Shift analytical focus from individual behavior to systemic social conditions

Emphasizing structural causes redirects explanation toward social systems rather than personal character, which is the sociologist's analytical move.

Question 115: The review research draws heavily on data from population studies in Finland, where sauna use is far higher than in most other nations. Which of the following is more feasible in Finland than elsewhere, based on the data?

• Improved marriage satisfaction rates.
• More gold medals in adolescent skiing.
• An 86-year old male mayor who is revered in the community. (Correct answer)
• Increased rate of pets in the household.

Correct answer: An 86-year old male mayor who is revered in the community.

The passage highlights Finland's high sauna use and its relevance to population studies. While not explicitly stated, high sauna use is often associated with health benefits and longevity in Finnish culture. An 86-year-old mayor suggests a population with good health and an active elderly demographic, which aligns with potential positive outcomes from widespread cultural practices like sauna use.

Question 116: Neonatal Respiratory Distress Syndrome (NRDS) is a significant issue that occurs when a baby is born prematurely and their ability to assist oxygen passage through their alveolar membranes is disrupted. This is due to a lack of surfactant production. What role does surfactant play in the diffusion of oxygen?

• Depresses cilia of the lung
• Increases surface permeability
• Maintains alveoli in an open state (Correct answer)
• Dilates blood vessels

Correct answer: Maintains alveoli in an open state

Surfactant is a lipoprotein complex that reduces the surface tension within the alveoli of the lungs. By lowering surface tension, surfactant prevents the small alveolar sacs from collapsing during exhalation, thus maintaining them in an open state. This ensures a larger surface area for efficient gas exchange, including oxygen diffusion.

Question 117: Which of the following best characterizes an institutional review board's (IRB) primary concern in research with human subjects?

• Ensuring participant welfare, informed consent, and ethical treatment (Correct answer)
• Maximizing statistical power of the study
• Minimizing research costs
• Guaranteeing publication of all research findings

Correct answer: Ensuring participant welfare, informed consent, and ethical treatment

IRBs exist to protect human research participants by reviewing studies for ethical standards, including informed consent, risk minimization, and voluntary participation.

Question 118: A HISTORY PASSAGE <br> In the late 18th century, citizens throughout rural Massachusetts shut down courthouses attempting to conduct debt collection hearings, farmers in western Pennsylvania and other parts of the western frontier refused to pay an excise on whiskey, and members of the Pennsylvania Dutch community in the east of the state harassed officials attempting to assess a direct tax on houses. In each case, the government's initial response to protests of "taxation without representation" led to an exacerbation of tensions: radicalized citizens banded together, creating armed militias in open rebellion against the ruling regime. <be> These popular uprisings against taxation and economic hardship were not—as many Americans would now assume upon hearing such descriptions—revolts against the British monarchy in prelude to the American Revolution (1775–83). Rather, Shays' Rebellion (1786–87), the Whiskey Rebellion (1791–94), and Fries's Rebellion (1798–1800) occurred after the British had been vanquished. Though each episode has distinctive historical significance, it is particularly instructive to examine the evolving reaction to popular protest by the incipient United States government. <br> In the case of the uprisings throughout western and central Massachusetts that would come collectively to be known as "Shays' Rebellion," the federal government existed in a much attenuated form, enfeebled due to the considerable amount of sovereignty ceded to the thirteen original states under the Articles of Confederation. After subsistence farmers, veterans of the Continental Army, and other rural citizens found themselves hard-pressed in 1786 by debts incurred during hard times and taxes newly levied by the Massachusetts government, they began to revolt, at first just closing down courts but soon organizing armed militias, culminating in an attempt led by veteran Daniel Shays to seize a federal armory in Springfield. The federal government lacked the funds to assemble its own militia and counter the uprising, so it was left to the governor of Massachusetts, James Bowdoin, to handle—and he had to turn to assistance from more than a hundred wealthy merchants to bankroll mercenaries, who quashed the rebels. <br> The moneyed and propertied interests—creditors to whom many debts were owed—had been unnerved by the events in Massachusetts, and were instrumental in the creation and ratification of the new Constitution, which greatly concentrated power in a more robust central government. When many western farmers refused to pay a 1791 excise tax on whiskey, the newly empowered federal government was able to muster a formidable response after resistance grew more organized. In 1794, President Washington himself led a massive federalized militia of nearly 13,000 troops that would effortlessly scatter the resistance forces. The reaction by President Adams to the smaller rebellion led by John Fries years later would be similarly heavy-handed. <br> This tendency toward increased centralization of power has only worsened since the 18th century. As the federal government has accumulated strength, state and municipal governments—and, ultimately, the people—have lost their sovereignty. And while the moneyed had to foot the bill directly to protect their property (and continue collecting their rents) in quelling Shays' Rebellion, since the adoption of the new Constitution in 1789, the federal government has been able to make the people pay directly for their own repression—a fact recently highlighted in the assault, covertly orchestrated across several cities by the Federal Bureau of Investigation and Department of Homeland Security, on the 2011 Occupy movement. In the end, the people have only traded one master for another: the feudal relic of British monarchy has been usurped by a modern bureaucratic behemoth, ultimately in thrall to the nouveau aristocracy of corporate "persons" and the rapacious class of executives that constitute the homunculi within. <br> "The federal government has been able to make the people directly pay for their own repression," the author states in paragraph 5. Based on the rest of the paragraph, this is most likely meant to convey the following:

• imprisoned protestors are sent a bill for the expenses accrued while they are behind bars.
• the government requires citizens to pay taxes, which are partly used to fund police and military responses to protests. (Correct answer)
• protesting ultimately incurs worse consequences for individuals today than it did in the 18th century.
• popular uprisings no longer occur in the United States due to more successful control of citizens.

Correct answer: the government requires citizens to pay taxes, which are partly used to fund police and military responses to protests.

The passage contrasts the quelling of Shays' Rebellion, where 'the moneyed had to foot the bill directly,' with the post-Constitution era. It states that 'since the adoption of the new Constitution in 1789, the federal government has been able to make the people pay directly for their own repression.' This implies that citizens, through their taxes, fund the government's police and military forces, which are then used to suppress popular protests, effectively making the people finance their own control.

Question 119: What is the role of a control group in scientific experiments related to MCAT?

• To confirm the hypothesis
• To receive the experimental treatment
• To provide a baseline for comparison (Correct answer)
• To be eliminated from the study

Correct answer: To provide a baseline for comparison

The control group provides a baseline against which the experimental group is compared to determine the effect of the variable being tested.

Question 120: According to the gate control theory of pain, which neural mechanism can reduce the perception of pain?

• Activation of C fibers transmitting slow, burning pain
• Opening of pain gates by emotional distress signals from the cortex
• Decreased serotonin in the dorsal horn of the spinal cord
• Stimulation of large-diameter A-beta fibers that activate inhibitory interneurons (Correct answer)

Correct answer: Stimulation of large-diameter A-beta fibers that activate inhibitory interneurons

Large-diameter A-beta fibers activate inhibitory interneurons in the dorsal horn that 'close the gate,' reducing transmission of pain signals to the brain.

Question 121: A researcher studies how repeated exposure to a neutral stimulus paired with a fear-inducing stimulus eventually causes the neutral stimulus alone to elicit fear. Which learning paradigm best describes this?

• Operant conditioning
• Habituation
• Classical conditioning (Correct answer)
• Observational learning

Correct answer: Classical conditioning

Classical conditioning pairs a neutral conditioned stimulus with an unconditioned stimulus until the neutral stimulus alone elicits a conditioned response.

Question 122: In the photoelectric effect, increasing the intensity of incident light (without changing frequency) will:

• Increase the stopping potential
• Have no effect because intensity doesn't affect the photoelectric effect
• Increase the number of emitted electrons per second (Correct answer)
• Increase the kinetic energy of emitted electrons

Correct answer: Increase the number of emitted electrons per second

Higher intensity means more photons per second, which ejects more electrons per second, but does not change each electron's kinetic energy.

Question 123: Which nerve innervates the diaphragm?

• Thoracic splanchnic nerve
• Intercostal nerves
• Vagus nerve (CN X)
• Phrenic nerve (C3-C5) (Correct answer)

Correct answer: Phrenic nerve (C3-C5)

The phrenic nerve, arising from cervical spinal levels C3-C5, provides motor innervation to the diaphragm.

Question 124: What are the author's thoughts on the philosophers of his era?

• He believes they have answered all the questions they can of this time.
• He believes that they hold too much power.
• He believes there are too few philosophers asking questions.
• He believes there is an emerging wave of philosophers who believe in the definition of truth by its opposite. (Correct answer)

Correct answer: He believes there is an emerging wave of philosophers who believe in the definition of truth by its opposite.

The author criticizes 'metaphysicians of all times' for their 'belief in antitheses of values' and their failure to question whether 'truth out of error' or 'generous deed out of selfishness' is possible. He then expresses anticipation for 'new philosophers beginning to appear' who will embrace 'dangerous 'Perhapses'' and explore the possibility that good and evil are 'essentially identical.' This indicates the author believes a new wave of thinkers will challenge the traditional separation of values and explore the interconnectedness of apparent opposites.

Question 125: In Piaget's theory, the process of modifying an existing schema to incorporate new information that doesn't fit is called:

• Equilibration
• Object permanence
• Accommodation (Correct answer)
• Assimilation

Correct answer: Accommodation

Accommodation involves changing or creating new schemas when new information cannot be assimilated into existing cognitive structures.

Question 126: The long thoracic nerve, which innervates the serratus anterior, arises from which roots?

• C5-C8
• C6-C8
• C4-C6
• C5-C7 (Correct answer)

Correct answer: C5-C7

The long thoracic nerve arises from roots C5, C6, and C7 and runs along the lateral chest wall to innervate the serratus anterior.

Question 127: A researcher crosses true-breeding red flowers with true-breeding white flowers and obtains all pink flowers in F1. This result is best explained by:

• Codominance
• X-linkage
• Complete dominance of red over white
• Incomplete dominance (Correct answer)

Correct answer: Incomplete dominance

Incomplete dominance produces a blended intermediate phenotype (pink) in heterozygotes because neither allele is fully dominant over the other.

Question 128: In CRISPR-Cas9 gene editing, the guide RNA (gRNA) functions to:

• Synthesize a new complementary DNA strand at the target site
• Transcribe the target gene into mRNA
• Direct the Cas9 endonuclease to a specific genomic sequence via complementary base pairing (Correct answer)
• Methylate the target DNA to silence the gene

Correct answer: Direct the Cas9 endonuclease to a specific genomic sequence via complementary base pairing

The guide RNA contains a spacer sequence complementary to the target genomic DNA, directing Cas9 to the precise location where it introduces a double-strand break.

Question 129: What is the product when an ester reacts with excess LiAlH4 followed by aqueous workup?

• Aldehyde + alcohol
• Ketone + alcohol
• Carboxylic acid + alcohol
• Two alcohols (Correct answer)

Correct answer: Two alcohols

LiAlH4 reduces esters all the way to two alcohols: one from the acyl portion and one from the alkoxide leaving group (both end up as primary alcohols).

Question 130: A hospital notices that patients with lower health literacy are less likely to follow discharge instructions, leading to higher readmission rates. A functionalist would most likely attribute this pattern to:

• A mismatch between institutional communication norms and patients' cultural backgrounds (Correct answer)
• Individual laziness and lack of motivation to follow medical advice
• Deliberate exclusion of low-literacy patients from quality care
• Corporate profit motives in the healthcare system

Correct answer: A mismatch between institutional communication norms and patients' cultural backgrounds

Functionalism emphasizes how different parts of the social system must work together; health literacy gaps represent a dysfunction between healthcare institutions and patient populations.

Question 131: When answering a CARS 'Which of the following best describes the organization of the passage?' question, the most reliable approach is to:

• Identify the subject matter and select the answer that best describes it
• Choose the answer that mentions the most topics covered in the passage
• Map the logical progression of the argument paragraph by paragraph, then match it to an answer choice (Correct answer)
• Select the most detailed answer choice, as it is most likely to be accurate

Correct answer: Map the logical progression of the argument paragraph by paragraph, then match it to an answer choice

Structure questions require tracking how the argument unfolds logically across paragraphs, not just identifying topics or selecting the most detailed option.

Question 132: Sensory adaptation is best illustrated by which of the following examples?

• No longer noticing the smell of a bakery after being inside for 20 minutes (Correct answer)
• Becoming more sensitive to pain after an injury
• A rat learning to press a lever for food pellets
• Flinching at an unexpected loud sound

Correct answer: No longer noticing the smell of a bakery after being inside for 20 minutes

Sensory adaptation refers to the diminished sensitivity to a constant stimulus over time, as receptor firing decreases with prolonged exposure.

Question 133: Which approach best demonstrates mastery of sociology in MCAT practice?

• Avoiding complex scenarios
• Following procedures without understanding
• Relying entirely on technology
• Applying principles to novel situations with sound judgment (Correct answer)

Correct answer: Applying principles to novel situations with sound judgment

True mastery involves understanding underlying principles well enough to apply them to new and unfamiliar situations with professional judgment.

Question 134: In a series circuit, two resistors of 4 Ω and 6 Ω are connected to a 20 V battery. What is the current through the circuit?

• 2 A (Correct answer)
• 1 A
• 4 A
• 5 A

Correct answer: 2 A

Total resistance = 4 + 6 = 10 Ω; current I = V/R = 20/10 = 2 A.

Question 135: What is the hybridization of the carbon atom in CO₂?

• sp³d
• sp³
• sp²
• sp (Correct answer)

Correct answer: sp

Carbon in CO₂ forms two double bonds with oxygen, requiring two sp hybrid orbitals and two unhybridized p orbitals for the π bonds.

Question 136: During their adolescent years, Cystic Fibrosis (CF) patients frequently experience a loss of pancreatic activity. Which enzyme's absence, if isolated, would have the greatest impact on nutrient absorption?

• Carboxypeptidase
• Lipase
• Trypsinogen (Correct answer)
• Elastinogen

Correct answer: Trypsinogen

Trypsinogen is the inactive precursor to trypsin, a crucial pancreatic enzyme responsible for digesting proteins in the small intestine. Its absence would severely impair the breakdown of proteins into smaller peptides and amino acids, leading to significant malabsorption of essential nutrients. While other enzymes are important, trypsin is a primary protease.

Question 137: Which structure passes through the carpal tunnel along with the nine flexor tendons?

• Ulnar nerve
• Anterior interosseous nerve
• Radial nerve
• Median nerve (Correct answer)

Correct answer: Median nerve

The median nerve and nine flexor tendons (4 FDS, 4 FDP, 1 FPL) pass through the carpal tunnel.

Question 138: The 'looking-glass self' theory developed by Charles Cooley suggests that one's self-concept is primarily shaped by:

• Formal education and socialization institutions
• How one imagines others perceive and judge them (Correct answer)
• Comparison with role models in the media
• Biological drives and temperament established in infancy

Correct answer: How one imagines others perceive and judge them

Cooley's looking-glass self proposes that individuals develop their identity based on how they think others see them, including imagining others' judgments.

Question 139: What is the primary unit of structure and function in living organisms studied in MCAT?

• Organ
• Molecule
• Cell (Correct answer)
• Tissue

Correct answer: Cell

The cell is the fundamental unit of structure and function in all living organisms, forming the basis of biological organization.

Question 140: A missense mutation results in which of the following outcomes?

• A premature stop codon
• A different amino acid incorporated into the protein (Correct answer)
• Deletion of an entire codon
• No change in the amino acid sequence

Correct answer: A different amino acid incorporated into the protein

A missense mutation changes a single nucleotide, altering the codon so that a different amino acid is incorporated at that position in the polypeptide chain.

Question 141: Which of the following best illustrates the concept of 'relative deprivation'?

• An unemployed individual who cannot afford basic necessities
• A student who performs below average compared to national standards
• A factory worker who feels poor after moving to a wealthy neighborhood, despite earning the same income (Correct answer)
• A person who lacks clean water and sufficient food in a developing nation

Correct answer: A factory worker who feels poor after moving to a wealthy neighborhood, despite earning the same income

Relative deprivation is the subjective sense of disadvantage experienced when individuals compare themselves to a reference group that has more.

Question 142: A passage argues that modern art has lost its ability to challenge society because it is now commercially driven. The author's primary concern is that:

• Art museums are no longer accessible to the public
• Commercial pressures have undermined art's critical social function (Correct answer)
• Government arts funding has decreased significantly
• Modern artists lack technical training compared to classical painters

Correct answer: Commercial pressures have undermined art's critical social function

The author's central worry is that commercial motives have displaced art's traditional role as a vehicle for social critique.

Question 143: A CARS passage contrasts two historians' interpretations of the same event. One emphasizes economic causes; the other emphasizes ideological causes. The passage most likely intends to illustrate:

• That professional historians rarely agree on basic facts
• That the event in question has no single definitive cause
• That historical interpretation depends on the theoretical framework the historian employs (Correct answer)
• That economic explanations are always superior to ideological ones

Correct answer: That historical interpretation depends on the theoretical framework the historian employs

Presenting competing interpretations is a classic device to show how a scholar's guiding framework shapes what they emphasize and conclude.

Question 144: Which of the following was a likely basis for the creation of the 22nd Amendment?

• The system of checks and balances prevents power from being held by any one branch.
• Interstate trade was shown to improve the growth of an overall national economy.
• The oppression by a monarchy previously was an example of abuse of power. (Correct answer)
• Citizens never wanted to be subject to the government’s force.

Correct answer: The oppression by a monarchy previously was an example of abuse of power.

The passage notes that the 22nd Amendment limited presidents to two terms, stating 'Originally presidents were eligible for continual reelection.' This restriction on executive power reflects a historical concern about the concentration of power and potential for tyranny, similar to the abuses associated with monarchies. The American Revolution was fought against a monarchy, and limiting presidential terms helps prevent a similar long-term hold on power.

Question 145: 1. The Will to Truth, which is to tempt us to many a hazardous enterprise, the famous Truthfulness of which all philosophers have hitherto spoken with respect, what questions has this Will to Truth not laid before us! What strange, perplexing, questionable questions! It is already a long story, yet it seems as if it were hardly commenced. Is it any wonder if we, at last, grow distrustful, lose patience, and turn impatiently away? That this Sphinx teaches us at last to ask questions ourselves? WHO is it really that puts questions to us here? WHAT really is this "Will to Truth" in us? In fact, we made a long halt at the question as to the origin of this Will—until at last, we came to an absolute standstill before a yet more fundamental question. We inquired about the VALUE of this Will. Granted that we want the truth: WHY NOT RATHER untruth? And uncertainty? Even ignorance? The problem of the value of truth presented itself before us—or was it we who presented ourselves before the problem? Which of us is Oedipus here? Which the Sphinx? It would seem to be a rendezvous of questions and notes of interrogation. And could it be believed that it, at last, seems to us as if the problem had never been propounded before as if we were the first to discern it, get a sight of it, and RISK RAISING it? For there is risk in raising it, perhaps there is no greater risk. <br> 2. "HOW COULD anything originate out of its opposite? For example, truth out of error? or the Will to Truth out of the will to deception? or the generous deed out of selfishness? or the pure sun-bright vision of the wise man out of covetousness? Such genesis is impossible; whoever dreams of it is a fool, nay, worse than a fool; things of the highest value must have a different origin, an origin of THEIR own—in this transitory, seductive, illusory, paltry world, in this turmoil of delusion and cupidity, they cannot have their source. But rather in the lap of Being, in the in transitory, in the concealed God, in the 'Thing-in-itself—THERE must be their source, and nowhere else!"—This mode of reasoning discloses the typical prejudice by which metaphysicians of all times can be recognized, this mode of valuation is at the back of all their logical procedure; through this "belief" of theirs, they exert themselves for their "knowledge," for something that is in the end solemnly christened "the Truth." The fundamental belief of metaphysicians is THE BELIEF IN ANTITHESES OF VALUES. It never occurred even to the wariest of them to doubt here on the very threshold (where doubt, however, was most necessary); though they had made a solemn vow, "DE OMNIBUS DUBITANDUM." For it may be doubted, firstly, whether antitheses exist at all; and secondly, whether the popular valuations and antitheses of value upon which metaphysicians have set their seal are not perhaps merely superficial estimates, merely provisional perspectives, besides being probably made from some corner, perhaps from below—"frog perspectives," as it were, to borrow an expression current among painters. In spite of all the value which may belong to the true, the positive, and the unselfish, it might be possible that a higher and more fundamental value for life generally should be assigned to pretense, to the will to delusion, to selfishness, and cupidity. It might even be possible that WHAT constitutes the value of those good and respected things, consists precisely in their being insidiously related, knotted, and crocheted to these evil and apparently opposed things—perhaps even in being essentially identical with them. Perhaps! But who wishes to concern himself with such dangerous "Perhapses"! For that investigation, one must await the advent of a new order of philosophers, such as will have other tastes and inclinations, the reverse of those hitherto prevalent—philosophers of the dangerous "Perhaps" in every sense of the term. <br> And to speak in all seriousness, I see such new philosophers beginning to appear. <br> Which of the following definitions of Nietzsche's Will to Truth is the most accurate?

• Our desire for love.
• A subset of our ego that acts towards what is right.
• Moral drive to act toward what is good.
• An intrinsic desire to know the truth. (Correct answer)

Correct answer: An intrinsic desire to know the truth.

The passage introduces 'The Will to Truth' as something that 'tempt[s] us to many a hazardous enterprise' and prompts the question, 'WHAT really is this 'Will to Truth' in us?'. This framing suggests an inherent, internal drive or impulse within humans to seek and value truth. It's an intrinsic desire that the author then proceeds to question the value of.

Question 146: Which of the following best describes the 'fundamental attribution error'?

• Attributing others' failures to situational factors while attributing one's own failures to dispositional factors
• Overestimating dispositional factors and underestimating situational factors when explaining others' behavior (Correct answer)
• Believing that one's own views are more widely shared than they actually are
• Attributing positive outcomes to one's own effort and negative outcomes to external causes

Correct answer: Overestimating dispositional factors and underestimating situational factors when explaining others' behavior

The fundamental attribution error is the tendency to overweight internal (dispositional) factors and underweight situational factors when judging others' behavior.

Question 147: Which stimulus has the most impact on circadian rhythms?

• light (Correct answer)
• pressure
• temperature
• pain

Correct answer: light

Light is the most significant environmental cue, or zeitgeber, that influences and synchronizes our circadian rhythms. Specialized photoreceptors in the retina detect light and send signals to the suprachiasmatic nucleus (SCN) in the hypothalamus, which acts as the body's master clock, regulating sleep-wake cycles and other biological processes.

Question 148: Ceramide is the backbone molecule for which class of lipids?

• Sterols
• Glycerophospholipids
• Sphingolipids (Correct answer)
• Triacylglycerols

Correct answer: Sphingolipids

Ceramide consists of sphingosine plus a fatty acid and is the core structure of all sphingolipids, including sphingomyelin and glycosphingolipids.

Question 149: According to Erikson's psychosocial stages, the central conflict for adolescents (ages 12–18) is best described as:

• Identity vs. Role Confusion (Correct answer)
• Industry vs. Inferiority
• Intimacy vs. Isolation
• Autonomy vs. Shame and Doubt

Correct answer: Identity vs. Role Confusion

Erikson's fifth stage, Identity vs. Role Confusion, occurs during adolescence and involves developing a coherent sense of self.

Question 150: A proton (charge +e) moves perpendicular to a magnetic field B with speed v. What is the radius of its circular orbit? (mass = m)

• mv²/(eB)
• eBv/m
• eB/(mv)
• mv/(eB) (Correct answer)

Correct answer: mv/(eB)

The magnetic force provides centripetal force: evB = mv²/r → r = mv/(eB).

Question 151: A young woman visits the clinic because she believes her "heart is racing." Her pulse is within normal limits when measured. During the conversation, you learn that she is frequently concerned about a variety of issues. In fact, she can't recall a time when she didn't have some event replaying in her mind. She acknowledges that she seeks out relationships to boost her self-esteem and that she stays in them for far too long because she is afraid of being alone. What personality type does this person belong to?

• Cluster C (Correct answer)
• Cluster A
• This does not seem like a personality disorder.
• Cluster B

Correct answer: Cluster C

The young woman's symptoms—frequent worry, chronic anxiety, seeking relationships for self-esteem, and fear of being alone—are characteristic of Cluster C personality disorders. This cluster includes anxious and fearful disorders like Dependent Personality Disorder, which is marked by an excessive need to be cared for, leading to submissive and clinging behavior and fears of separation.

Question 152: What is the first stage of cognitive development, according to Piaget?

• Preoperational
• Formal Operational
• Concrete Operational
• Sensorimotor (Correct answer)

Correct answer: Sensorimotor

Jean Piaget's theory of cognitive development outlines four stages. The sensorimotor stage is the first, occurring from birth to approximately two years of age. During this stage, infants learn about the world primarily through their senses and motor actions, developing object permanence and basic understanding of cause and effect.

Question 153: A patient cannot recognize faces even though visual acuity is intact. This condition is called:

• Agnosia for objects
• Achromatopsia
• Hemianopia
• Prosopagnosia (Correct answer)

Correct answer: Prosopagnosia

Prosopagnosia is the selective inability to recognize familiar faces, typically associated with damage to the fusiform face area.

Question 154: A young child is taken to a psychologist to have their home circumstances evaluated. The mother is on one side and the psychologist is on the other while the child is placed in the middle of the floor. The mother then departs for a brief while before returning. Which of the following would be a red flag during this assessment?

• Exploring the room before the mother leaves.
• Crying and returning to the mother upon return.
• Avoiding the mother upon return. (Correct answer)
• Decreased exploration when the mother is out of the room.

Correct answer: Avoiding the mother upon return.

This scenario describes the 'Strange Situation' experiment, designed to assess attachment styles. Avoiding the mother upon her return is a key indicator of an insecure-avoidant attachment style. In this pattern, the child shows little distress when the mother leaves and actively avoids or ignores her upon her return, which is considered a red flag for healthy attachment development.

Question 155: Which of the following correctly describes a diamagnetic species?

• It contains unpaired electrons and is attracted to a magnetic field
• It contains only paired electrons and is weakly repelled by a magnetic field (Correct answer)
• It contains unpaired electrons and is repelled by a magnetic field
• It contains only paired electrons and is strongly attracted to a magnetic field

Correct answer: It contains only paired electrons and is weakly repelled by a magnetic field

Diamagnetic species have all electrons paired; they experience weak repulsion in a magnetic field because paired electrons cancel each other's magnetic moments.

Question 156: Which DNA repair mechanism corrects thymine dimers caused by UV radiation?

• Nucleotide excision repair (Correct answer)
• Homologous recombination
• Base excision repair
• Mismatch repair

Correct answer: Nucleotide excision repair

Nucleotide excision repair (NER) removes bulky lesions like UV-induced thymine dimers by excising a ~12-24 nucleotide oligonucleotide containing the lesion.

Question 157: According to Erikson's psychosocial stages, the central conflict of adolescence is:

• Intimacy vs. Isolation
• Autonomy vs. Shame and Doubt
• Identity vs. Role Confusion (Correct answer)
• Industry vs. Inferiority

Correct answer: Identity vs. Role Confusion

During adolescence (ages 12–18), Erikson's stage centers on forming a coherent identity versus experiencing confusion about one's role in society.

Question 158: A group of engineers working on signal lights for planes that may be used to guide them to runways is trying to figure out how bright the light needs to be for the pilot to notice the tower from a mile away. They adjust the brightness of the light to a test level and establish contact with an oncoming pilot. The pilot claims he can't see the light while he's a mile away from the tower. What would this be called in terms of Signal Detection Theory?

• Correct rejection
• Hit
• False alarm
• Miss (Correct answer)

Correct answer: Miss

Answer Explanation: (A) <br> Signal Detection Theory deals with the expectation of a signal and the corresponding reality that it is accurately perceived. Hit and miss describe reactions by the observer when the stimulus is present. False alarm (false positive) and correct rejection describe reactions by the observer when the stimulus is absent.

Question 159: Which intermolecular force is responsible for the unusually high surface tension of water?

• London dispersion forces
• Hydrogen bonding (Correct answer)
• Dipole-dipole interactions
• Ion-dipole interactions

Correct answer: Hydrogen bonding

Water's extensive hydrogen bonding network creates strong cohesive forces between molecules, resulting in high surface tension.

Question 160: Which muscle is the primary medial rotator and adductor of the arm?

• Infraspinatus
• Subscapularis (Correct answer)
• Teres minor
• Supraspinatus

Correct answer: Subscapularis

The subscapularis is the largest rotator cuff muscle and the primary medial rotator of the humerus; it also adducts the arm.

Question 161: Classical conditioning differs from operant conditioning primarily in that classical conditioning:

• Uses reinforcement to increase voluntary behavior
• Relies on punishment to eliminate behavior
• Requires conscious awareness of the contingency
• Associates a neutral stimulus with an involuntary response (Correct answer)

Correct answer: Associates a neutral stimulus with an involuntary response

Classical conditioning pairs a conditioned stimulus with an unconditioned stimulus to elicit an involuntary conditioned response, without requiring voluntary action.

Question 162: Wrist drop results from injury to which nerve?

• Median nerve
• Musculocutaneous nerve
• Radial nerve (Correct answer)
• Ulnar nerve

Correct answer: Radial nerve

Radial nerve injury causes wrist drop due to loss of innervation to the wrist and finger extensors.

Question 163: Which reagent converts a primary alcohol to an aldehyde without over-oxidizing to a carboxylic acid?

• PCC (pyridinium chlorochromate) (Correct answer)
• H2CrO4
• KMnO4
• K2Cr2O7

Correct answer: PCC (pyridinium chlorochromate)

PCC selectively oxidizes primary alcohols to aldehydes and stops there because it lacks aqueous conditions needed for further oxidation.

Question 164: A patient presents with elevated homocysteine levels. Which vitamin deficiency is most likely responsible?

• Vitamin C (ascorbate)
• Vitamin B6 (pyridoxine)
• Vitamin B1 (thiamine)
• Vitamin B12 (cobalamin) (Correct answer)

Correct answer: Vitamin B12 (cobalamin)

Vitamin B12 is required for the conversion of homocysteine to methionine; its deficiency causes homocysteine accumulation.

Question 165: In the second paragraph, the author makes which of the following assumptions?

• The response to Fries's Rebellion was more heavy-handed than the response to Shays' Rebellion.
• A significant number of Americans today are unfamiliar with the rebellions that occurred after the Revolution. (Correct answer)
• C)The British monarchy is entirely unlike the US federal government that eventually replaced it.
• The British played a covert role in the rebellions that took place after their defeat in the American Revolution.

Correct answer: A significant number of Americans today are unfamiliar with the rebellions that occurred after the Revolution.

The second paragraph states, 'These popular uprisings... were not—as many Americans would now assume upon hearing such descriptions—revolts against the British monarchy.' The phrase 'as many Americans would now assume' directly indicates the author's belief that a significant portion of the contemporary American population is unaware of these specific post-Revolutionary rebellions, leading them to misinterpret the initial descriptions.

Question 166: Which event occurs during the S phase of the cell cycle?

• DNA replication (Correct answer)
• Spindle formation
• Chromosome condensation
• Cytokinesis

Correct answer: DNA replication

During the S (synthesis) phase of interphase, the entire genome is replicated so that each chromosome consists of two identical sister chromatids.

Question 167: Which reading strategy is most effective when a CARS passage contains an unfamiliar technical term central to the argument?

• Assume the term has the same meaning as its everyday English usage
• Skip the sentence containing the term and return to it after finishing the passage
• Infer the term's meaning from surrounding context and the passage's overall argument (Correct answer)
• Look for a parenthetical definition earlier in the passage before attempting to infer meaning

Correct answer: Infer the term's meaning from surrounding context and the passage's overall argument

Context-based inference is the most reliable strategy on the MCAT CARS section because the answer to vocabulary-in-context questions is always grounded in how the author uses the term.

Question 168: A reaction has ΔG° = +20 kJ/mol at 298 K. Which statement is correct?

• The equilibrium constant K < 1 (Correct answer)
• The reaction cannot proceed in the reverse direction
• The reaction is exothermic
• The reaction is spontaneous under standard conditions

Correct answer: The equilibrium constant K < 1

A positive ΔG° means the reaction is non-spontaneous under standard conditions, and since ΔG° = -RT ln K, a positive ΔG° requires K < 1.

Question 169: What role does collaboration play in sociology for MCAT professionals?

• It enhances outcomes through diverse perspectives and shared expertise (Correct answer)
• It reduces individual accountability
• It slows down work unnecessarily
• It is only needed in emergencies

Correct answer: It enhances outcomes through diverse perspectives and shared expertise

Collaboration leverages diverse perspectives and combined expertise to achieve better outcomes than any individual could alone.

Question 170: What is the best way to describe Sergey's relationship with his half-brother?

• Affectionate (Correct answer)
• Maternalistic
• Tense
• Distant

Correct answer: Affectionate

While Sergey initially greets Levin with 'chilly friendliness,' he later demonstrates understanding and patience. When Levin asks his question, Sergey 'smiled and said: ‘That question we have no right to answer as yet.’' He comprehends Levin's 'simple and natural point of view,' which contrasts sharply with the professor's annoyance. This ability to gently engage and understand his brother, despite the academic setting, indicates an underlying affectionate or at least deeply respectful and understanding bond.

Question 171: Which memory category would explicit memory fall into?

• short-term memory
• procedural memory
• sensory memory
• long-term memory (Correct answer)

Correct answer: long-term memory

Explicit memory, also known as declarative memory, refers to memories that are consciously recalled, such as facts, events, and concepts. This type of memory is a component of long-term memory, which has a vast capacity and can store information for extended periods, ranging from minutes to a lifetime.

Question 172: A first-generation college student who excels academically but struggles to network with professors due to not knowing unwritten professional norms is experiencing a deficit in:

• Human capital
• Social capital
• Economic capital
• Cultural capital (Correct answer)

Correct answer: Cultural capital

Cultural capital includes the knowledge, behaviors, and skills that confer advantages in navigating institutions like higher education, which first-generation students may lack.

Question 173: Which immunoglobulin class is the first to be produced during a primary immune response?

• IgG
• IgE
• IgA
• IgM (Correct answer)

Correct answer: IgM

IgM is the first antibody produced during a primary immune response due to its pentameric structure and early B cell expression before class switching occurs.

Question 174: A child watches an adult punch a doll and later imitates this behavior. This best demonstrates:

• Insight learning
• Classical conditioning
• Observational (social) learning (Correct answer)
• Operant conditioning

Correct answer: Observational (social) learning

Bandura's Bobo doll experiments showed that children learn aggressive behaviors by observing and imitating models, illustrating observational learning.

Question 175: A strand of RNA that typically forms a transmembrane protein that aids potassium entrance into muscle cells has been altered to produce a different strand. The original strand goes like this: <br> GAAUAGAUGGGAAGCGCCAGAUACAGUAACAGA… The following is the modified sequence: <br> GAAUAGAUGGGAAGCGCCAGAUACAGUACCAGA…

• Production of a larger, likely dysfunctional protein (Correct answer)
• Production of a smaller, likely dysfunctional protein
• Production of a similar-sized but dysfunctional protein
• No change
• Absence of the protein

Correct answer: Production of a larger, likely dysfunctional protein

Answer Explanation: (E) <br> The change here was a single base substitution in the stop codon of this sequence (UAA) to a regular protein sequence (UAC). Remember that the start of translation is always at AUG, and remember the stop codons UAA, UGA, UAG. If this stop codon was removed, there would be continued translation down the strand, resulting in a larger protein, which would likely be dysfunctional.

Question 176: DNA methylation of CpG islands in a gene's promoter region typically results in:

• Increased mutation rate at that locus
• Histone acetylation and chromatin relaxation
• Gene silencing and decreased transcription (Correct answer)
• Increased gene expression due to enhanced polymerase binding

Correct answer: Gene silencing and decreased transcription

Methylation of CpG islands in promoter regions recruits methyl-CpG-binding repressor proteins and blocks transcription factor binding, leading to gene silencing.

Question 177: A patient arrives at the emergency room very disturbed. They're acting irrationally and insisting they need medication or "terrible things" will happen if they don't. What is the most likely status of the dopamine system in this patient?

• There are decreased dopamine receptors on the post-synaptic membrane. (Correct answer)
• There is seizure-like activity in the dopamine brain areas.
• There is decreased dopamine in the synaptic cleft.
• There is cell death in the areas with high dopamine cells.

Correct answer: There are decreased dopamine receptors on the post-synaptic membrane.

The patient's irrational behavior and distress are highly suggestive of psychosis, often associated with disorders like schizophrenia. These conditions are linked to excessive dopamine activity in certain brain regions (hyperdopaminergia). While acute psychosis involves increased dopamine signaling, the brain can undergo compensatory changes, such as a downregulation or decrease in post-synaptic dopamine receptors, in response to chronic overstimulation to try and reduce the overall impact of high dopamine levels.

Question 178: Which scientific method step follows hypothesis formation?

• Observation
• Conclusion
• Publication
• Experimentation and testing (Correct answer)

Correct answer: Experimentation and testing

After forming a hypothesis, the next step is designing and conducting experiments to test whether the hypothesis is supported by evidence.

Question 179: During DNA replication, which enzyme synthesizes new DNA strands in the 5' to 3' direction by adding nucleotides to the growing chain?

• DNA polymerase III (Correct answer)
• DNA helicase
• DNA ligase
• DNA primase

Correct answer: DNA polymerase III

DNA polymerase III is the primary replicative polymerase in prokaryotes, extending the new strand by adding deoxyribonucleotides to the 3'-OH end in the 5' to 3' direction.

Question 180: The lymphatic drainage of the testes follows which vessels to drain into which lymph nodes?

• Testicular (gonadal) vessels to para-aortic nodes (Correct answer)
• External iliac vessels to external iliac nodes
• Internal iliac vessels to internal iliac nodes
• Inguinal vessels to superficial inguinal nodes

Correct answer: Testicular (gonadal) vessels to para-aortic nodes

The testes drain to para-aortic (lumbar) lymph nodes because the testes developed retroperitoneally near the kidneys before descending.

Question 181: A researcher finds that children who watch aggressive TV shows become more aggressive. A critic argues that aggressive children simply prefer aggressive shows. This critique raises concerns about:

• Directionality (reverse causation) in correlational research (Correct answer)
• Construct validity
• External validity
• Demand characteristics

Correct answer: Directionality (reverse causation) in correlational research

The directionality problem in correlational studies means we cannot determine from the association alone whether TV causes aggression or aggression causes TV preference.

Question 182: The Constitution concisely organizes the country’s basic political institutions. The main text comprises seven articles. Article I vests all legislative powers in the Congress—the House of Representatives and the Senate. The Great Compromise stipulated that representation in the House would be based on population, and each state is entitled to two senators. Members of the House serve terms of two years, senators terms of six. Among the powers delegated to Congress are the right to levy taxes, borrow money, regulate interstate commerce, provide for military forces, declare war, and determine member seating and rules of procedure. The House initiates impeachment proceedings, and the Senate adjudicates them. <br> Article II vests executive power in the office of the presidency of the United States. The president, selected by an electoral college to serve a four-year term, is given responsibilities common to chief executives, including serving as commander in chief of the armed forces, negotiating treaties (two-thirds of the Senate must concur), and granting pardons. The president’s vast appointment powers, which include members of the federal judiciary and the cabinet, are subject to the “advice and consent” (majority approval) of the Senate (Article II, Section 2). Originally presidents were eligible for continual reelection, but the Twenty-second Amendment (1951) later prohibited any person from being elected president more than twice. Although the formal powers of the president are constitutionally quite limited and vague in comparison with those of the Congress, a variety of historical and technological factors—such as the centralization of power in the executive branch during war and the advent of television—have increased the informal responsibilities of the office extensively to embrace other aspects of political leadership, including proposing legislation to Congress. <br> The federal government is obliged by many constitutional provisions to respect the individual citizen’s basic rights. Some civil liberties were specified in the original document, notably in the provisions guaranteeing the writ of habeas corpus and trial by jury in criminal cases (Article III, Section 2) and forbidding bills of attainder and ex post facto laws (Article I, Section 9). But the most significant limitations to government’s power over the individual were added in 1791 in the Bill of Rights. The Constitution’s First Amendment guarantees the rights of conscience, such as freedom of religion, speech, and the press, and the right of peaceful assembly and petition. Other guarantees in the Bill of Rights require fair procedures for persons accused of a crime—such as protection against unreasonable search and seizure, compulsory self-incrimination, double jeopardy, and excessive bail—and guarantees of a speedy and public trial by a local, impartial jury before an impartial judge and representation by counsel. Rights of private property are also guaranteed. Although the Bill of Rights is a is a broad expression of individual civil liberties, the ambiguous wording of many of its provisions—such as the Second Amendment’s right “to keep and bear arms” and the Eighth Amendment’s prohibition of “cruel and unusual punishments”—has been a source of constitutional controversy and intense political debate. Further, the rights guaranteed are not absolute, and there has been considerable disagreement about the extent to which they limit governmental authority. The Bill of Rights originally protected citizens only from the national government. For example, although the Constitution prohibited the establishment of an official religion at the national level, the official state-supported religion of Massachusetts was Congregationalism until 1833. Thus, individual citizens had to look to state constitutions for protection of their rights against state governments. <br> During the early stages of the Afghan War, intelligence agencies used psychological techniques such as sleep deprivation and waterboarding on interrogated captives. Which section of the constitution, according to the report, would prevent this from happening to American citizens?

• Eighth Amendment (Correct answer)
• Second Amendment
• Article I
• Article III

Correct answer: Eighth Amendment

The passage explicitly mentions the 'Eighth Amendment’s prohibition of 'cruel and unusual punishments'' as a guarantee within the Bill of Rights. Sleep deprivation and waterboarding are widely considered forms of torture or cruel and unusual punishment. Therefore, this amendment would be the constitutional provision designed to prevent such practices from being inflicted upon American citizens.

Question 183: In a dihybrid cross between two heterozygous parents (AaBb × AaBb), what is the expected phenotypic ratio in the offspring?

• 9:3:3:1 (Correct answer)
• 1:1:1:1
• 3:1
• 1:2:1

Correct answer: 9:3:3:1

A dihybrid cross between two double heterozygotes yields a 9:3:3:1 phenotypic ratio when the genes assort independently, producing four distinct phenotypic classes.

Question 184: Which glycolytic intermediate is also a precursor for the synthesis of serine?

• Glucose-6-phosphate
• Fructose-6-phosphate
• 3-Phosphoglycerate (Correct answer)
• Phosphoenolpyruvate

Correct answer: 3-Phosphoglycerate

3-Phosphoglycerate is diverted from glycolysis to form serine via the phosphoserine pathway.

Question 185: Which of the following correctly describes Hess's Law?

• The entropy change determines whether a reaction is exothermic
• The total enthalpy change for a reaction equals the sum of enthalpy changes for individual steps (Correct answer)
• Enthalpy changes are always negative for spontaneous reactions
• The enthalpy change of a reaction depends on the pathway taken

Correct answer: The total enthalpy change for a reaction equals the sum of enthalpy changes for individual steps

Hess's Law states that since enthalpy is a state function, the total ΔH for a reaction is the sum of ΔH values for each step, regardless of the path taken.

Question 186: The autonomic nervous system's parasympathetic branch is characterized by which neurotransmitter at the target organ?

• Acetylcholine (Correct answer)
• Norepinephrine
• Epinephrine
• Dopamine

Correct answer: Acetylcholine

Parasympathetic postganglionic neurons release acetylcholine onto target organs, mediating 'rest-and-digest' functions.

Question 187: Which of the following best describes 'social capital' as used by Pierre Bourdieu and Robert Putnam?

• The network of social relationships and connections that provide individuals with access to resources and opportunities (Correct answer)
• The cultural knowledge required to navigate higher education institutions
• The accumulated wealth that a social class passes down through generations
• The economic value assigned to unpaid social labor such as caregiving

Correct answer: The network of social relationships and connections that provide individuals with access to resources and opportunities

Social capital refers to the benefits individuals gain through their social networks, including information, support, and access to opportunities.

Question 188: According to Maslow's hierarchy of needs, which level must generally be satisfied before an individual can focus on esteem needs?

• Cognitive needs
• Transcendence needs
• Aesthetic needs
• Belongingness and love needs (Correct answer)

Correct answer: Belongingness and love needs

In Maslow's hierarchy, belongingness and love needs (social needs) fall below esteem needs and must be reasonably met first.

Question 189: On arriving in Moscow by a morning train, Levin had put up at the house of his elder half-brother, Koznishev. After changing his clothes he went down to his brother’s study, intending to talk to him at once about the object of his visit, and to ask his advice; but his brother was not alone. With him there was a well-known professor of philosophy, who had come from Harkov expressly to clear up a difference that had arisen between them on a very important philosophical question. The professor was carrying on a hot crusade against materialists. Sergey Koznishev had been following this crusade with interest, and after reading the professor’s last article, he had written him a letter stating his objections. He accused the professor of making too great concessions to the materialists. And the professor had promptly appeared to argue the matter out. The point in discussion was the question then in vogue: Is there a line to be drawn between psychological and physiological phenomena in man? and if so, where? Sergey Ivanovitch met his brother with the smile of chilly friendliness he always had for everyone, and introducing him to the professor, went on with the conversation. A little man in spectacles, with a narrow forehead, tore himself from the discussion for an instant to greet Levin, and then went on talking without paying any further attention to him. Levin sat down to wait till the professor should go, but he soon began to get interested in the subject under discussion. Levin had come across the magazine articles about which they were disputing, and had read them, interested in them as a development of the first principles of science, familiar to him as a natural science student at the university. But he had never connected these scientific deductions as to the origin of man as an animal, as to reflex action, biology, and sociology, with those questions as to the meaning of life and death to himself, which had of late been more and more often in his mind. As he listened to his brother’s argument with the professor, he noticed that they connected these scientific questions with those spiritual problems, that at times they almost touched on the latter; but every time they were close upon what seemed to him the chief point, they promptly beat a hasty retreat, and plunged again into a sea of subtle distinctions, reservations, quotations, allusions, and appeals to authorities, and it was with difficulty that he understood what they were talking about. ‘I cannot admit it,’ said Sergey Ivanovitch, with his habitual clearness, precision of expression, and elegance of phrase. ‘I cannot in any case agree with Keiss that my whole conception of the external world has been derived from perceptions. The most fundamental idea, the idea of existence, has not been received by me through sensation; indeed, there is no special sense-organ for the transmission of such an idea.’ ‘Yes, but they—Wurt, and Knaust, and Pripasov—would answer that your consciousness of existence is derived from the conjunction of all your sensations, that that consciousness of existence is the result of your sensations. Wurt, indeed, says plainly that, assuming there are no sensations, it follows that there is no idea of existence.’ ‘I maintain the contrary,’ began Sergey Ivanovitch. But here it seemed to Levin that just as they were close upon the real point of the matter, they were again retreating, and he made up his mind to put a question to the professor. ‘According to that, if my senses are annihilated, if my body is dead, I can have no existence of any sort?’ he queried. The professor, in annoyance, and, as it were, mental suffering at the interruption, looked round at the strange inquirer, more like a bargeman than a philosopher, and turned his eyes upon Sergey Ivanovitch, as though to ask: What’s one to say to him? But Sergey Ivanovitch, who had been talking with far less heat and one-sidedness than the professor, and who had sufficient breadth of mind to answer the professor, and at the same time to comprehend the simple and natural point of view from which the question was put, smiled and said: ‘That question we have no right to answer as yet.’ ‘We have not the requisite data,’ chimed in the professor, and he went back to his argument. ‘No,’ he said; ‘I would point out the fact that if, as Pripasov directly asserts, perception is based on sensation, then we are bound to distinguish sharply between these two conceptions.’ Levin listened no more, and simply waited for the professor to go. <br> How would you describe Levin's personality?

• Boisterous
• Timid (Correct answer)
• Unintelligent
• Arrogant

Correct answer: Timid

Levin's actions throughout the passage suggest timidity. He 'sat down to wait till the professor should go' and only asks a question after some hesitation. When he does speak, the professor reacts with 'annoyance' and dismisses him as 'more like a bargeman than a philosopher,' indicating Levin is perceived as an outsider and is not assertive in this academic environment.

Question 190: During translation, which RNA molecule carries specific amino acids to the ribosome?

• snRNA (small nuclear RNA)
• tRNA (transfer RNA) (Correct answer)
• mRNA (messenger RNA)
• rRNA (ribosomal RNA)

Correct answer: tRNA (transfer RNA)

Transfer RNA (tRNA) molecules serve as adaptors, each carrying a specific amino acid and containing an anticodon that base-pairs with the complementary mRNA codon at the ribosome.

Question 191: In MCAT science preparation, what does homeostasis refer to?

• Rapid growth
• Cell division
• The tendency to maintain stable internal conditions (Correct answer)
• Energy production

Correct answer: The tendency to maintain stable internal conditions

Homeostasis is the process by which organisms maintain stable internal conditions necessary for survival despite external changes.

Question 192: An economist's passage claims that rent control reduces housing supply in the long run. A city planner counters that rent control preserves affordable housing in the short run. These two positions:

• Are based on incompatible definitions of 'affordable housing'
• Agree that rent control is ultimately beneficial for low-income residents
• Operate on different time horizons and may both be correct within their own frames (Correct answer)
• Are mutually exclusive and cannot both be true

Correct answer: Operate on different time horizons and may both be correct within their own frames

The economist addresses long-run supply effects while the planner addresses short-run affordability; both claims can be true simultaneously because they address different time frames.

Question 193: Which of the following paragraphs is most likely to follow this snippet in the article?

• A recap of Finland’s water polo team excellence.
• A study on rats exposed to high levels of heat.
• A paragraph on a protein that facilitates intracellular function in response to heat.
• A paragraph on increased heart attacks in Eskimo populations.

The preceding snippet introduces research on high sauna use in Finland and its relevance to population studies. A logical next step in such an article would be to explore the physiological mechanisms by which heat exposure, like that from saunas, impacts the human body. Discussing a protein that facilitates intracellular function in response to heat directly addresses the biological underpinnings of the observed effects.

Question 194: During meiosis I, homologous chromosomes separate. This division reduces the chromosome number from:

• Haploid (n) to diploid (2n)
• Diploid (2n) to haploid (n) (Correct answer)
• Haploid (n) to haploid (n)
• Tetraploid (4n) to diploid (2n)

Correct answer: Diploid (2n) to haploid (n)

Meiosis I is the reductional division where homologous chromosome pairs separate, halving the chromosome number from diploid (2n) to haploid (n) in each resulting cell.

Question 195: Vygotsky's sociocultural development theory tries to explain the relationship between the mental functions that children are born with and how they develop into adulthood. The zone of proximal development is a key component of this. Which of the following statements best defines a person in the proximal development zone?

• A high school English student submits a paper for review by his professor.
• A concert flute player falls short of finishing a piece that has a very complex ending without mistakes
• A high diver takes instruction from her coach to improve her form on a specific move. (Correct answer)
• A baseball player hits baseballs from a tee in order to build muscle memory.

Correct answer: A high diver takes instruction from her coach to improve her form on a specific move.

Vygotsky's Zone of Proximal Development (ZPD) refers to the gap between what a learner can achieve independently and what they can achieve with guidance from a more knowledgeable other (MKO). The high diver receiving instruction from her coach to improve a specific move perfectly illustrates this, as she is learning a skill just beyond her current independent ability with expert assistance.

Question 196: What may be the next probable passage in the book after this?

• A parable on evolution.
• A background in Sphinx and Oedipal mythology.
• The author discussing characteristics of things that are truthful. (Correct answer)
• A biographical summary of the current philosophers of the time.

Correct answer: The author discussing characteristics of things that are truthful.

The author concludes the passage by stating, 'And to speak in all seriousness, I see such new philosophers beginning to appear.' These new philosophers are described as those who will 'concern himself with such dangerous 'Perhapses'!' and question the 'VALUE of this Will [to Truth],' including whether good and evil are 'essentially identical.' Therefore, the next probable passage would logically delve into these new philosophical perspectives, likely by discussing the nature and characteristics of truth, or its perceived opposites, from this fresh viewpoint.

Question 197: The diathesis-stress model of mental illness proposes that:

• Psychological disorders are purely learned behaviors
• Genetic factors fully determine psychological disorders
• Stress alone causes all mental disorders
• A biological predisposition combined with environmental stressors leads to mental illness (Correct answer)

Correct answer: A biological predisposition combined with environmental stressors leads to mental illness

The diathesis-stress model posits that a genetic or biological vulnerability (diathesis) interacts with environmental stressors to produce psychological disorders.

Question 198: A health disparity is observed where Black Americans have significantly higher rates of hypertension than white Americans. Which social determinant most directly explains this difference?

• Genetic predisposition unrelated to environment
• Chronic stress from racial discrimination and socioeconomic inequality (Correct answer)
• Lack of interest in healthcare among Black communities
• Biological inability to metabolize antihypertensives

Correct answer: Chronic stress from racial discrimination and socioeconomic inequality

Chronic psychosocial stress from racism, discrimination, and socioeconomic disadvantage is a major driver of hypertension disparities in Black Americans.

Question 199: According to the James-Lange Emotion Theory __.

• a person’s thoughts about physiological reactions determine emotions
• physiological changes influence emotions (Correct answer)
• emotions cause physiological reactions
• physiological changes have no influence on emotions

Correct answer: physiological changes influence emotions

The James-Lange theory of emotion proposes that our experience of emotion is a result of our physiological responses to stimuli. It suggests that we first perceive a stimulus, then experience a physiological reaction (e.g., increased heart rate), and *then* interpret these bodily changes as a specific emotion. Therefore, physiological changes directly influence emotions.

Question 200: An author writes: 'One could argue that technology isolates individuals, but this view ignores how social media sustains long-distance relationships.' The phrase 'one could argue' signals:

• The author's own position on technology
• A fact the author treats as settled
• A position the author introduces only to then rebut or qualify (Correct answer)
• A view the author will ultimately endorse

Correct answer: A position the author introduces only to then rebut or qualify

'One could argue' is a distancing phrase that typically introduces a view the author is about to counter or complicate rather than endorse.

Question 201: Which linkage type is found in cellulose but NOT in starch?

• α-1,6-glycosidic
• β-1,4-glycosidic (Correct answer)
• β-1,6-glycosidic
• α-1,4-glycosidic

Correct answer: β-1,4-glycosidic

Cellulose consists of glucose monomers joined by β-1,4-glycosidic bonds, which humans cannot digest, unlike the α-1,4 bonds in starch.

Question 202: Which property of sound waves increases when the medium's temperature rises?

• Wavelength in a constant-frequency wave only
• Frequency
• Speed (Correct answer)
• Amplitude

Correct answer: Speed

Sound speed in a gas increases with temperature because molecules move faster, transmitting vibrations more quickly.

Question 203: A patient who cannot form new long-term memories but retains memories from before their brain injury most likely has damage to which structure?

• Amygdala
• Cerebellum
• Prefrontal cortex
• Hippocampus (Correct answer)

Correct answer: Hippocampus

The hippocampus is critical for encoding new declarative (explicit) memories; damage causes anterograde amnesia while leaving older memories intact.

Question 204: A passage about legal philosophy argues that laws derive legitimacy from social consensus rather than from natural law or divine authority. A question asks which scenario would most challenge this view. The best answer is:

• A legislature debates a bill for several months before passing it
• Citizens regularly follow laws even when they disagree with them
• International human rights agreements are ratified by most nations
• A democratic majority passes a law later found to violate individual rights (Correct answer)

Correct answer: A democratic majority passes a law later found to violate individual rights

If a law emerges from social consensus yet violates rights, it challenges the idea that consensus alone is sufficient for legitimacy—suggesting laws may need an external standard beyond mere agreement.

Question 205: An individual comes to the clinic for an initial evaluation and to begin treatment. The patient was born as a 46-year-old man named XY, but she identifies as a woman. She/Her are her preferred pronouns. Furthermore, she is only sexually active with females. What would you use to characterize this person's gender and sexual orientation?

• Transgender, heterosexual
• Cis-gender, heterosexual
• Cis-gender, homosexual
• Transgender, homosexual (Correct answer)

Correct answer: Transgender, homosexual

Answer Explanation: (B) <br> Gender discussions are becoming increasingly important in the field of medicine as of late. In order to appropriately address this, these definitions have become more important. Gender is spoken of in relation to what biological sex the infant has, whereas sexual orientation is described in relation to the individual’s identified gender.

Question 206: An author states: 'The Romantic poets were reacting against the rationalism of the Enlightenment.' This claim implies that Enlightenment rationalism was:

• Irrelevant to understanding nineteenth-century poetry
• Compatible with Romantic values of emotional expression
• Primarily a literary rather than philosophical movement
• A dominant cultural force that Romantic poets found inadequate or oppressive (Correct answer)

Correct answer: A dominant cultural force that Romantic poets found inadequate or oppressive

To 'react against' something implies it was sufficiently powerful and present that it provoked a deliberate counter-movement.

Question 207: A study finds that people perform better on simple tasks when others are present, but worse on complex tasks. This phenomenon is called:

• Deindividuation
• Social loafing
• Social facilitation (Correct answer)
• Groupthink

Correct answer: Social facilitation

Social facilitation refers to the tendency for the presence of others to enhance performance on well-learned tasks and impair performance on difficult or novel tasks.

Question 208: Which type of joint is the pubic symphysis?

• Synchondrosis
• Synovial joint
• Symphysis (secondary cartilaginous joint) (Correct answer)
• Syndesmosis

Correct answer: Symphysis (secondary cartilaginous joint)

The pubic symphysis is a secondary cartilaginous joint (symphysis) united by fibrocartilage, allowing limited movement.

Question 209: A sociologist observes that people in higher socioeconomic classes have better access to healthcare, education, and nutrition. This pattern is best explained by which concept?

• Social loafing
• Social mobility
• Relative deprivation
• Social stratification (Correct answer)

Correct answer: Social stratification

Social stratification refers to the hierarchical ranking of individuals or groups in society based on wealth, power, and prestige, leading to differential access to resources.

Question 210: On a weekday, a psychology study was set up directly outside the gym on a college campus. Chocolate chip cookies were handed out directly outside the door, and a sign was posted 15 feet down the hall asking visitors to avoid taking the stairs, forcing them to walk around in a longer corridor. Apart from the warning, there were no obstacles to accessing the stairs. The results showed that those who accepted a sweet from the platter were twice as likely to use the longer hallway than those who rejected. What psychological notion is this an illustration of?

• Insecure attachment
• Learned helplessness
• Ego depletion (Correct answer)
• Tyranny of choice

Correct answer: Ego depletion

Answer Explanation: (A) <br> This question tests the concept of ego depletion. Ego depletion is the theory that self control is an exhaustible resource, and that, in individuals who are tested on their self control, they will be less and less likely to resist temptations in sequential order. In this study, the students who refused the cookie then had less self control to avoid using the stairs.

Question 211: In a CARS passage, the author uses the phrase 'to be sure' before presenting a counterargument. This phrase most commonly signals:

• The author's confident assertion of the main thesis
• A concession the author grants before returning to defend the main argument (Correct answer)
• A factual claim the author considers beyond dispute
• The author's endorsement of the opposing view

Correct answer: A concession the author grants before returning to defend the main argument

'To be sure' typically introduces a concession—an acknowledgment that the opposing view has some merit—before the author reasserts or qualifies the main argument.

Question 212: How would this compound be labeled correctly using nomenclature rules? <br> After successfully synthesizing their drug, the same scientist employed a more sophisticated process that used bromine. She was left with the following structure after the response was finished:

• 6-bromo-4-ethyl-decadiene
• 5-bromo-7-ethyl-5-didecene
• 6-bromo-4-ethyl-3,5-decadiene (Correct answer)
• 5-bromo-7-ethyl-5,7-decadiene

Correct answer: 6-bromo-4-ethyl-3,5-decadiene

To correctly name this compound, first identify the longest carbon chain containing both double bonds, which is a 10-carbon chain (decadiene). Number the chain to give the double bonds the lowest possible locants, placing them at positions 3 and 5. Then, identify and number the substituents: an ethyl group at carbon 4 and a bromine atom at carbon 6. Finally, arrange the substituents alphabetically (bromo before ethyl) with their respective numbers, leading to the name 6-bromo-4-ethyl-3,5-decadiene.

Question 213: A patient with damage to Wernicke's area would most likely present with:

• Fluent but nonsensical speech with poor comprehension (Correct answer)
• Inability to produce speech (Broca's aphasia)
• Complete mutism
• Loss of reading ability only

Correct answer: Fluent but nonsensical speech with poor comprehension

Wernicke's aphasia results in fluent, grammatically intact but semantically incoherent speech and impaired language comprehension.

Question 214: Which statement best describes the inductive effect of a fluorine substituent on benzoic acid?

• It has no effect on acidity
• It withdraws electrons inductively, lowering pKa (Correct answer)
• It donates electrons inductively, raising pKa
• It donates electrons via resonance, raising pKa

Correct answer: It withdraws electrons inductively, lowering pKa

Fluorine is highly electronegative and withdraws electron density inductively, stabilizing the carboxylate anion and lowering the pKa (increasing acidity).

Question 215: A passage traces how 'progress' changed meaning from a religious concept (divine plan) to a secular concept (scientific advancement) during the Enlightenment. The author's primary purpose is most likely to:

• Argue that religious notions of progress are superior to secular ones
• Demonstrate that the Enlightenment rejected all religious ideas
• Show how a key concept's meaning shifts across historical and intellectual contexts (Correct answer)
• Prove that scientific advancement is the only valid form of progress

Correct answer: Show how a key concept's meaning shifts across historical and intellectual contexts

Tracing semantic shifts over historical periods is a classic humanities method for showing how ideas are culturally and historically constructed.

Question 216: Which amino acid is most commonly found at the active site of serine proteases?

• Histidine
• Cysteine
• Serine (Correct answer)
• Aspartate

Correct answer: Serine

Serine proteases (e.g., trypsin, chymotrypsin) use a catalytic triad of Ser-His-Asp, but serine is the nucleophile that attacks the peptide bond.

Question 217: Which brain structure is most critically involved in the formation of new declarative memories?

• Hippocampus (Correct answer)
• Amygdala
• Basal ganglia
• Cerebellum

Correct answer: Hippocampus

The hippocampus is essential for consolidating new declarative (explicit) memories, including episodic and semantic information.

Question 218: Two point charges of +2 μC and +8 μC are 12 cm apart. At what distance from the +2 μC charge does the electric field equal zero?

• 4 cm (Correct answer)
• 8 cm
• 2 cm
• 6 cm

Correct answer: 4 cm

Setting kQ₁/r² = kQ₂/(d–r)²: 2/r² = 8/(12–r)²; solving gives r = 4 cm from the +2 μC charge.

Question 219: A wrestler seeking to lose weight for a December competition sets a goal of losing 30 pounds in two months. Which of the following is NOT an effective way to limit his caloric intake?

• Snap himself with a rubber band when he eats a high calorie snack.
• Hide snack food out of sight within his house. (Correct answer)
• Study at a health smoothie store instead of a coffee shop.
• Reward himself with a savory meal every Saturday for meeting his calorie goals.

Correct answer: Hide snack food out of sight within his house.

The question asks which method is *NOT* an effective way to limit caloric intake. While hiding snack food might reduce impulsive eating by removing visual cues, it doesn't eliminate the food from the environment or address underlying cravings. If the individual knows the food is still present and accessible, they can still retrieve and consume it, making it a less effective long-term strategy for truly limiting overall caloric intake compared to other behavioral interventions.

Question 220: During meiosis I, crossing over between homologous chromosomes occurs at which structure?

• Synaptonemal complex/chiasmata (Correct answer)
• Centromere
• Kinetochore
• Telomere

Correct answer: Synaptonemal complex/chiasmata

Crossing over (recombination) occurs at chiasmata within the synaptonemal complex during prophase I of meiosis, exchanging segments between homologous chromosomes.

Question 221: Which of the following hormones is released by the adrenal medulla during the acute stress response?

• Testosterone
• Epinephrine (Correct answer)
• Aldosterone
• Cortisol

Correct answer: Epinephrine

The adrenal medulla releases epinephrine (and norepinephrine) as part of the fight-or-flight response, rapidly mobilizing energy and increasing heart rate.

Question 222: The lac operon in E. coli is an example of which type of gene regulation?

• Both positive and negative regulation (Correct answer)
• Post-translational regulation
• Negative regulation only
• Positive regulation only

Correct answer: Both positive and negative regulation

The lac operon is regulated negatively by the lac repressor (which blocks transcription without lactose) and positively by the CAP-cAMP complex (which enhances transcription when glucose is low).

Question 223: What is Levin's most likely profession, based on the passage?

• Farmer (Correct answer)
• Professor
• Philosopher
• Businessman

Correct answer: Farmer

When Levin asks a question, the professor looks at him 'more like a bargeman than a philosopher.' This comparison suggests Levin is seen as a working-class individual, someone engaged in manual labor rather than intellectual pursuits. While 'bargeman' isn't 'farmer,' it strongly implies a rural, non-academic background. Historically, and within the context of Tolstoy's *Anna Karenina* (from which this passage is taken), Levin is indeed a landowner deeply involved in farming and rural life, which aligns with this inference.

Question 224: A compound gives a positive Tollens' test (silver mirror) but does not react with Fehling's solution. Which compound is most likely?

• Acetone
• Glucose
• Fructose
• Benzaldehyde (Correct answer)

Correct answer: Benzaldehyde

Benzaldehyde is oxidized by Tollens' reagent (silver mirror) but its product is insoluble in Fehling's solution (copper-based), which requires water-soluble reducing sugars.

Question 225: Sauna use, sometimes referred to as "sauna bathing," is characterized by short-term passive exposure to extreme heat. This exposure elicits mild hyperthermia – an increase in the body's core temperature – that induces a thermoregulatory response involving neuroendocrine, cardiovascular, and cytoprotective mechanisms that work together to restore homeostasis and condition the body for future heat stressors… In recent decades, sauna bathing has emerged as a means to increase lifespan and improve overall health, based on compelling data from observational, interventional, and mechanistic studies. Of particular interest are the findings from studies of participants in the Kuopio Ischemic Heart Disease Risk Factor (KIHD) Study, an ongoing prospective population-based cohort study of health outcomes in more than 2,300 middle-aged men from eastern Finland, which identified strong links between sauna use and reduced death and disease… The KIHD findings showed that men who used the sauna two to three times per week were 27 percent less likely to die from cardiovascular-related causes than men who didn't use the sauna.[2] Furthermore, the benefits they experienced were found to be dose-dependent: Men who used the sauna roughly twice as often, about four to seven times per week, experienced roughly twice the benefits – and were 50 percent less likely to die from cardiovascular-related causes.[2] In addition, frequent sauna users were found to be 40 percent less likely to die from all causes of premature death. These findings held true even when considering age, activity levels, and lifestyle factors that might have influenced the men's health.[2]... The KIHD also revealed that frequent sauna use reduced the risk of developing dementia and Alzheimer's disease in a dose-dependent manner. Men who used the sauna two to three times per week had a 66 percent lower risk of developing dementia and a 65 percent lower risk of developing Alzheimer's disease, compared to men who used the sauna only one time per week… The health benefits associated with sauna use extended to other aspects of mental health, as well. Men participating in the KIHD study who used the sauna four to seven times per week were 77 percent less likely to develop psychotic disorders, regardless of the men's dietary habits, socioeconomic status, physical activity, and inflammatory status (as measured by C-reactive protein)…Exposure to high temperature stresses the body, eliciting a rapid, robust response. The skin and core body temperatures increase markedly, and sweating ensues. The skin heats first, rising to 40°C (104°F), and then changes in core body temperature occur, rising slowly from 37°C (98.6°F, or normal) to 38°C (100.4°F) and then rapidly increasing to 39°C (102.2°F)… Cardiac output, a measure of the amount of work the heart performs in response to the body's need for oxygen, increases by 60 to 70 percent, while the heart rate (the number of beats per minute) increases and the stroke volume (the amount of blood pumped) remains unchanged.[5] During this time, approximately 50 to 70 percent of the body's blood flow is redistributed from the core to the skin to facilitate sweating. The average person loses approximately 0.5 kg of sweat while sauna bathing.[11] Acute heat exposure also induces a transient increase in overall plasma volume to mitigate the decrease in core blood volume. This increase in plasma volume not only provides a reserve source of fluid for sweating, but it also acts like the water in a car's radiator, cooling the body to prevent rapid increases in core body temperature and promoting heat tolerance… Repeated sauna use acclimates the body to heat and optimizes the body's response to future exposures, likely due to a biological phenomenon known as hormesis, a compensatory defense response following exposure to a mild stressor that is disproportionate to the magnitude of the stressor. Hormesis triggers a vast array of protective mechanisms that not only repair cell damage but also provide protection from subsequent exposures to more devastating stressors… The physiological responses to sauna use are remarkably similar to those experienced during moderate- to vigorous-intensity exercise. In fact, sauna use has been proposed as an alternative to exercise for people who are unable to engage in physical activity due to chronic disease or physical limitations.[13] <br> Which of the following is NOT an advantage of sauna use, according to the article?

• Decreased risk of heart attacks.
• Decreased rate of erectile dysfunction. (Correct answer)
• Improved mental health.
• Increase in stroke volume.

Correct answer: Decreased rate of erectile dysfunction.

The article explicitly mentions several advantages of sauna use, including improved mental health (reduced risk of dementia, Alzheimer's, psychotic disorders), decreased risk of heart attacks (reduced cardiovascular-related causes of death), and an increase in cardiac output. However, there is no mention or discussion of erectile dysfunction or its rate anywhere in the provided text. While cardiac output increases, the article states stroke volume remains unchanged.

Question 226: A uniform rod of length L and mass m is pivoted at one end. What is its moment of inertia about the pivot?

• mL²
• mL²/2
• mL²/3 (Correct answer)
• mL²/4

Correct answer: mL²/3

For a uniform rod pivoted at one end, I = mL²/3.

Question 227: The Thomas Theorem states that:

• Social deviance is defined by those in power
• If people define situations as real, they are real in their consequences (Correct answer)
• Social structures constrain individual behavior regardless of personal beliefs
• Inequality is reproduced through cultural capital and education

Correct answer: If people define situations as real, they are real in their consequences

The Thomas Theorem holds that subjective perceptions of reality shape behavior and outcomes, even when those perceptions may be objectively incorrect.

Question 228: David is a senior in high school who aspires to be an engineer. He scores a F on his first test in calculus II sophomore year. Which of the following reactions to this experience would indicate that David is more likely to improve in future exams?

• He says it was due to some home circumstances that won’t be present during the next exam.
• He says the teacher graded his exam harder because she doesn’t like him.
• He decides that the first test is always harder than the others.
• He critiques his study methods and tries to find out which led to poor returns. (Correct answer)

Correct answer: He critiques his study methods and tries to find out which led to poor returns.

Answer Explanation: <br> This question focuses on the differences between internal and external locus of control. People with internal locus of control blame outcomes on their personal efforts and abilities, while those with an external locus of control contributes outcomes to fate or forces beyond their control. People with an internal locus of control tend to have more success following failures.

Question 229: A CARS passage presents an argument that ends with: 'For these reasons, the conclusion seems inescapable.' The phrase 'seems inescapable' is best interpreted as:

• A hedged claim that the author believes the argument is strong but implicitly acknowledges possible objections (Correct answer)
• An invitation for the reader to reach their own independent conclusion
• A sign that the author is uncertain about the argument's validity
• A confident assertion that no reasonable person could disagree

Correct answer: A hedged claim that the author believes the argument is strong but implicitly acknowledges possible objections

'Seems' is a hedging word that qualifies the claim, signaling the author finds the conclusion very compelling while leaving slight room for alternative views.

Question 230: The saphenous nerve, the largest cutaneous branch of the femoral nerve, accompanies which vessel in the leg?

• Popliteal artery
• Great saphenous vein (Correct answer)
• Small saphenous vein
• Posterior tibial artery

Correct answer: Great saphenous vein

The saphenous nerve runs with the great saphenous vein along the medial aspect of the leg, providing cutaneous innervation to the medial leg and foot.

Question 231: What is the role of a control group in scientific experiments related to MCAT?

• To confirm the hypothesis
• To provide a baseline for comparison (Correct answer)
• To be eliminated from the study
• To receive the experimental treatment

Correct answer: To provide a baseline for comparison

The control group provides a baseline against which the experimental group is compared to determine the effect of the variable being tested.

Question 232: What part of the brain is in charge of speech?

• Broca’s Area (Correct answer)
• occipital lobe
• hypothalamus
• cerebellum

Correct answer: Broca’s Area

Broca's Area, located in the frontal lobe of the dominant cerebral hemisphere (typically the left), is a critical brain region primarily responsible for the production of speech. Damage to this area can lead to Broca's aphasia, characterized by difficulty forming words and speaking fluently, while comprehension remains relatively intact.