MCAT (Chemical and Physical Foundations) — Questions and Answers

Question 1: While investigating mining samples off the coast of Columbia, a scientist discovers an element that has never been detected by humans. The molecule possesses an electronegativity similar to iron, according to extensive testing (Fe). What would the following values be regarding magnesium if the characteristics of this element were found to be consistent with iron? Make use of the periodic table as a guide.

Increased electronegativity, decreased ionization energy, decreased atomic radius
Decreased electronegativity, decreased ionization energy, decreased atomic radius
Increased electronegativity, increased ionization energy, decreased atomic radius (Correct answer)
Decreased electronegativity, increased ionization energy, increased atomic radius

Correct answer: Increased electronegativity, increased ionization energy, decreased atomic radius

Periodic trends indicate that as you move across a period from left to right and up a group, electronegativity and ionization energy generally increase, while atomic radius decreases. Magnesium (Mg) is in Group 2, Period 3. Iron (Fe) is a transition metal, located to the right and below Mg on the periodic table. Therefore, an element with characteristics similar to iron would have a higher electronegativity, higher ionization energy, and a smaller atomic radius compared to magnesium.

Question 2: How many grams of carbon dioxide would arise from a reaction with 84 grams of ethane and infinite oxygen (Carbon atomic weight: 12amu, Hydrogen atomic weight: 1amu, Oxygen atomic weight: 16amu) using this formula? The following is the imbalanced ethane gas reaction with carbon dioxide and water: CO2 + H2O (C2H4 + O2)

528g
156g
78g
264g (Correct answer)

Correct answer: 264g

First, balance the combustion reaction for ethene (C2H4): C2H4 + 3O2 → 2CO2 + 2H2O. Next, calculate the molar mass of C2H4, which is 28 g/mol. Given 84 grams of C2H4, this corresponds to 3 moles (84g / 28g/mol). According to the balanced equation, 1 mole of C2H4 produces 2 moles of CO2. Therefore, 3 moles of C2H4 will produce 6 moles of CO2. Finally, calculate the mass of 6 moles of CO2 (molar mass 44 g/mol): 6 moles * 44 g/mol = 264 grams.

Question 3: The equation below explains how ammonia is produced:

Increasing the amount of ammonia (NH3)
Increasing temperature
Decreasing the amount of hydrogen
Decreasing pressure
Increasing pressure (Correct answer)

Correct answer: Increasing pressure

The Haber-Bosch process for ammonia synthesis is N2(g) + 3H2(g) <=> 2NH3(g). This reaction involves 4 moles of gas on the reactant side and 2 moles of gas on the product side. According to Le Chatelier's Principle, increasing the pressure on a system at equilibrium will shift the equilibrium towards the side with fewer moles of gas to relieve the stress. In this case, increasing pressure will favor the formation of ammonia, thus increasing its yield.

Question 4: On a flat track with a ramp at the finish, a race car attempts to leap a string of eight buses. Engineers working on the project concluded that the car needed achieve a speed of 130 km/h in order to leap the buses. What rate must the car accelerate to obtain this velocity if the track distance is 50m?

17 m/s^2
13 m/s^2 (Correct answer)
26 m/s^2
7 m/s^2

Correct answer: 13 m/s^2

First, convert the final velocity from 130 km/h to m/s, which is approximately 36.11 m/s. Since the car starts from rest, the initial velocity is 0 m/s. Using the kinematic equation vf^2 = vi^2 + 2ad, and substituting the known values (36.11 m/s for vf, 0 m/s for vi, and 50 m for d), we can solve for acceleration (a). This yields an acceleration of approximately 13 m/s^2.

Question 5: A nozzle is always attached to the end of a fire hose, which works in part by reducing the area of water exiting the fire hydrant to create a more powerful stream. What is the final velocity of water as it exits a fire hydrant if the initial velocity is 2 m/s, pressure is held constant, and the end of the nozzle is 1/3 the area of the start of the hose?

6 m/s (Correct answer)
2 m/s
8 m/s
5 m/s

Correct answer: 6 m/s

This problem can be solved using the principle of continuity for incompressible fluids, which states that the product of the cross-sectional area and the fluid velocity remains constant (A1v1 = A2v2). Given that the initial velocity is 2 m/s and the nozzle reduces the area to one-third of the original (A2 = A1/3), we can set up the equation A1 * (2 m/s) = (A1/3) * v2. Solving for v2 yields a final velocity of 6 m/s.

Question 6: For this chemical, which of the following would be the correct nomenclature? Under spectroscopy, a laboratory-made chemical was discovered to contain the following structure:

4,6-diethyl-2-methylheptane
1-methyl-3,5-diethylhexane
1-methyl-3,5-diethyloctane
4,6-diethyl-2-methyloctane (Correct answer)

Correct answer: 4,6-diethyl-2-methyloctane

To name an alkane, first identify the longest continuous carbon chain, which in this case is an eight-carbon chain (octane). Next, number the chain from the end that gives the substituents the lowest possible numbers. With a methyl group at position 2 and two ethyl groups at positions 4 and 6, the name is constructed by listing the substituents alphabetically (diethyl before methyl) with their corresponding numbers. This results in the name 4,6-diethyl-2-methyloctane.

Question 7: How would this compound be labeled correctly using nomenclature rules? After successfully synthesizing their drug, the same scientist employed a more sophisticated process that used bromine. She was left with the following structure after the response was finished:

5-bromo-7-ethyl-5-didecene
6-bromo-4-ethyl-3,5-decadiene (Correct answer)
5-bromo-7-ethyl-5,7-decadiene
6-bromo-4-ethyl-decadiene

Correct answer: 6-bromo-4-ethyl-3,5-decadiene

To correctly name this compound, first identify the longest carbon chain containing both double bonds, which is a 10-carbon chain (decadiene). Number the chain to give the double bonds the lowest possible locants, placing them at positions 3 and 5. Then, identify and number the substituents: an ethyl group at carbon 4 and a bromine atom at carbon 6. Finally, arrange the substituents alphabetically (bromo before ethyl) with their respective numbers, leading to the name 6-bromo-4-ethyl-3,5-decadiene.

Question 8: In the laboratory, a transmembrane protein is discovered to be made up of four distinct amino acids in various amounts. Glycine, tyrosine, arginine, and isoleucine are the most common amino acids. Which amino acid is most likely to be found within the transmembrane domain?

Arginine
Isoleucine (Correct answer)
Glycine
Tyrosine

Correct answer: Isoleucine

Transmembrane domains of proteins are embedded within the lipid bilayer of the cell membrane. The interior of the lipid bilayer is highly hydrophobic. Therefore, amino acids found within this domain are typically nonpolar and hydrophobic. Among the given options, Isoleucine is a nonpolar, hydrophobic amino acid, making it the most likely to be found in the hydrophobic transmembrane region.

Question 9: A new enzyme is found in a transgenic mice that participates in synthesis of an unknown product using two reactants. When using radiolabeled compounds to study the enzyme, it is found that the enzyme catalyzes a process that switches a nitrogen group on one reactant to the other reactant. Which of the following categories would this new enzyme fall under?

Transferase (Correct answer)
Oxidoreductase
Lyase
Isomerase
Hydrolase

Correct answer: Transferase

Enzymes are classified into six main categories based on the type of reaction they catalyze. A transferase enzyme catalyzes the transfer of a functional group (like a nitrogen group, phosphate group, or methyl group) from one molecule (the donor) to another (the acceptor). The description of switching a nitrogen group from one reactant to another perfectly fits the definition of a transferase.

Question 10: On the third day of an evolution symposium, two scientists take the stage to debate their beliefs. Each is a passionate follower of their respective philosophy. According to the first scientist, organisms evolved by increasing the number of organs that were employed the most at the time. They'd then pass them down to future generations. The second scientist, on the other hand, believed that each organism's advantages were absent for a long time, then appeared at random, and when they were helpful, that organism would swiftly populate the population over a short period of time, according to evolution. Which of the following statements would support the argument of the second scientist?

A study that showed a species who were more successful due to the things they learned over their lifetime that they passed on to their children.
A study that shows that bodybuilders who train more have larger children.
A study that showed a consistent amount of time between the emergence of each new species.
A taxonomy study that shows long periods of stagnant growth followed by short burst of massive evolution. (Correct answer)

Correct answer: A taxonomy study that shows long periods of stagnant growth followed by short burst of massive evolution.

Scientist 2's view aligns with the theory of punctuated equilibrium, which proposes that evolution is characterized by long periods of little or no change (stasis) interrupted by brief periods of rapid speciation and evolutionary change. Therefore, a taxonomy study showing long periods of stagnant growth followed by short bursts of massive evolution would directly support the argument of the second scientist.

Question 11: A high school science teacher pours pure nitrogen into a 1 liter bottle and closes the lid. The room temperature is 25°C and the pressure is 1.70 atm. If all other factors remain constant, which two variables will both increase the system's pressure?

Increasing temperature, increasing volume
Decreasing moles of gas, increasing volume
Increasing temperature, increasing moles of gas (Correct answer)
Decreasing volume, decreasing temperature

Correct answer: Increasing temperature, increasing moles of gas

According to the ideal gas law (PV=nRT), pressure (P) is directly proportional to temperature (T) and the number of moles of gas (n), assuming volume (V) is constant. Therefore, increasing the temperature of the gas and increasing the number of moles of gas within the fixed volume will both independently lead to an increase in the system's pressure.

Question 12: Perchloric acid (HClO4) is one of the most powerful acids the world has ever known. Which of the following statements most closely describes strong acids?

They remain bound in the presence of water.
Ka is less than 1
They have an open electron spot on their outer valence rings
They have stable conjugate bases (Correct answer)

Correct answer: They have stable conjugate bases

Strong acids are characterized by their complete dissociation in water, meaning they readily donate a proton (H+). This complete dissociation is facilitated by the stability of their conjugate bases. A highly stable conjugate base is less likely to re-accept a proton, thus driving the equilibrium far to the product side (dissociation).

Question 13: R1 = 5, R2 = 10, R3 = 15, and V = 8.1V are the provided values for this circuit. Which of the following would cause the current to increase to 6.0A? Given above is the diagram of a resistor circuit:

Halving the voltage.
Doubling the voltage. (Correct answer)
Adding a fourth 10Ω resistor to the parallel circuit in parallel.
Adding a 10Ω resistor in series to the other resistors in the circuit.

Correct answer: Doubling the voltage.

First, calculate the total equivalent resistance of the circuit. Assuming R1, R2, and R3 are connected in parallel, the equivalent resistance is R_total = 30/11 Ω (approximately 2.73 Ω). Using Ohm's Law (I = V/R), the initial current is 8.1V / (30/11 Ω) ≈ 2.97 A. To increase the current to 6.0 A, which is approximately double the initial current, the voltage must also be doubled, as current is directly proportional to voltage when resistance is constant.

Question 14: A 1 meter tall jug of water springs a leak from a weak place in the plastic at the very bottom of the side, while sitting on a 2 meter high tabletop with its lid open. How quickly will the water in the jug empty?

2.22 m/s
4.47 m/s (Correct answer)
6.25 m/s
8.26 m/s

Correct answer: 4.47 m/s

Answer Explanation: (B) This is another question testing the principles of Bernoulli’s equation. However, since height is not involved, the conservation of energy equation is too simple. Several things in the equation can be simplified. Water has the same density, start velocity of standing water is zero, and pressure is the same since both are exposed to normal atmospheric pressure. Thus, the rearranged equation reads: (1/2)v22 = gh1 - gh2 Remember that, although a height for the countertop is given, it is irrelevant, since g remains the same. Thus h1 can be 1m, and h2 can be 0m, roughly. Solving for this will give you the answer. Tip: When possible, reduce out all stable variables. The equations will be much easier.

Question 15: Which of the following statements about the procedure described here (compound-titrating solution) is correct? In the lab, a titratable substance is submitted to titration. The graph below depicts the curve:

Strong base-weak acid
Weak acid-weak base
Weak base-strong acid (Correct answer)
Weak acid-strong base

Correct answer: Weak base-strong acid

Answer Explanation: (C) This question will help conceptually understand titration curves, with emphasis on the differentiating points that will determine the correct answer. Any solution being titrated, whether an acid or a base, will show a steep initial change near the y-axis if it is weak. That, along with the starting pH, gives you the starting substrate. Secondly, a rapid decline at the equivalence point (almost vertical) and a low final pH indicates that the titrating substance in this example is a strong acid. These facts altogether should elicit the correct answer on most of these questions.

Question 16: During DNA replication, around for per 100,000/1 million copies, an error is written into the leading strand. Several mechanisms are used to proofread this DNA. Which repair process is most likely at action if a mistake is discovered and the erroneous base is deleted immediately after the RNA primer is removed?

DNA polymerase III
Endonuclease repair
DNA polymerase I (Correct answer)
Mismatch repair mechanism

Correct answer: DNA polymerase I

Answer Explanation: (C) DNA repair is a crucial biological mechanism to ensure proper coding. The first line of defense against an improperly coded base is 3’-5’ activity by DNA polymerase III, which both synthesizes DNA and checks for mistakes in the reverse direction. Followed by this, DNA polymerase I, while removing the RNA primer, checks for mistakes in the 5’-3’ direction. Finally, mismatch repair proteins check synthesized DNA strands for mistakes. Endonuclease activity describes going inside a DNA strand to repair a mistake, whereas the mistake described above was corrected by excising a single base before ligation.

Question 17: A specific amount of 2-bromobutane is added to a strong ethanol solution and allowed to react completely. This reaction yields a major product of 2-butene and a minor product of 1-butene as a consequence. Which of the following statements about the beginning molecule best explains why 2-butene is the most important product?

1-butene rearranges to 2-butene in solution
Carbon 3 has less hydrogen atoms (Correct answer)
Cyclic aromatization
Ethanol prefers the second carbon in any chain

Correct answer: Carbon 3 has less hydrogen atoms

Answer Explanation: (B) This question assesses the test taker’s knowledge of Zaitsev’s Rule. The leading theory of this rule is that, in an E2 reaction of a strong base and a compound with 2 distinct beta carbon groups, the reaction will favor towards double bonding of the beta carbon with less hydrogens. It would be extremely helpful to visualize this on the test by writing it out if the starting compounds are simple, but if they are complex, knowing the current reasoning for this rule is sufficient.

Question 18: A sound technician is tasked with adjusting the frequency of a gunshot to more precisely match the typical speed of sound while working on a scene for an action film. The gunshot was fired by an actor inside a car going at 108 kilometers per hour, and it was captured by a camera on a platform 200 meters away traveling at 72 kilometers per hour in the same direction. What is the perceived frequency at which the camera picks up the gunshot if the frequency of the gunshot is generally 800Hz?

912 Hz
941 Hz
787 Hz
924 Hz (Correct answer)

Correct answer: 924 Hz

Answer Explanation: (D) According to the Doppler equation, when velocity is added to the direction in which sound is traveling, it will increase the relative frequency at which that sound is heard. The doppler equation is listed above: This equation leads to a fairly simple mathematical problem. Velocity of sound waves is 343 m/s and should be known, although it will usually be given. Thus, the answer is easily arrived at. To check work, make sure that if velocity is being added in the positive direction, that the frequency increases.

Question 19: A strand of RNA that typically forms a transmembrane protein that aids potassium entrance into muscle cells has been altered to produce a different strand. The original strand goes like this: GAAUAGAUGGGAAGCGCCAGAUACAGUAACAGA… The following is the modified sequence: GAAUAGAUGGGAAGCGCCAGAUACAGUACCAGA…

Production of a similar-sized but dysfunctional protein
Absence of the protein
Production of a smaller, likely dysfunctional protein
No change
Production of a larger, likely dysfunctional protein (Correct answer)

Correct answer: Production of a larger, likely dysfunctional protein

Answer Explanation: (E) The change here was a single base substitution in the stop codon of this sequence (UAA) to a regular protein sequence (UAC). Remember that the start of translation is always at AUG, and remember the stop codons UAA, UGA, UAG. If this stop codon was removed, there would be continued translation down the strand, resulting in a larger protein, which would likely be dysfunctional.

Question 20: The ability of the eukaryotic cell to compress coding sections when they are not being expressed is one of the numerous reasons why it can store so much information in its DNA. Which of the following processes will usually result in a decrease in gene expression when acting on DNA?

Increase in methylation activity (Correct answer)
Increased histone acetyltransferase activity
Increase in heterochromatin:euchromatin ratio
Decrease in histone deacetyltransferase activity

Correct answer: Increase in methylation activity

Answer Explanation: (A) This is a straightforward question that assesses knowledge of modification of DNA segments. Although in the real world these methods are not exclusive to increasing or decreasing activity, for MCAT testing purposes, histone acetyltransferase (HAT) frees DNA from histone proteins for expression. Histone deacetyltransferase (HDAC) binds DNA more tightly to histone, creating more heterochromatin, which is not expressed. Methylation is an epigenetic modification that generally trends toward silencing gene expression.

Question 21: What is the most precise description of the reaction displayed? Ca(OH)2 (aq) + H2SO4 (aq) → CaSO4 (aq) + H2O (l)

Neutralization (Correct answer)
Single-displacement
Oxidation–reduction
Double-displacement

Correct answer: Neutralization

The correct answer is: A This reaction is a classic example of a neutralization reaction, in which an acid and a base react to form a salt and, usually, water. Although this reaction also fits the criteria for a double- displacement reaction, choice (D), in which two molecules essentially exchange ions with each other, neutralization is a more specific description of the process.

Question 22: The kinetics of SN1 reactions are first-order because:

there is only one rate-limiting step.
the rate-limiting step is the first step to occur in the reaction.
the reaction involves only one molecule.
the rate-limiting step involves only one molecule. (Correct answer)

Correct answer: the rate-limiting step involves only one molecule.

The correct answer is: D An SN1 reaction is a first-order nucleophilic substitution reaction. It is called first-order because the rate-limiting step involves only one molecule. Choice (B) is true, but does not explain why SN1 reactions have first-order kinetics; the rate- limiting step of an SN2 reaction is also the first (and only) step of that reaction, but SN2 reactions have second-order kinetics, not first-order. Choice (A) is a true statement as well, but again does not explain why the reaction is first- order. Finally, choice (C) is incorrect because it is the rate- limiting step, not the reaction overall, that involves only one molecule.

Question 23: A man walks east for 30 meters and then north for 40 meters. What is the difference between his displacement and his traveled distance?

15 m
60 m
20 m (Correct answer)
10 m

Correct answer: 20 m

Using the Pythagorean theorem, calculate the magnitude of the man’s displacement: His total distance traveled is equal to 30 + 40 = 70 m. Therefore, the difference between these two is 20 m.

Question 24: A 30 kg female sits on the fulcrum of a seesaw at a distance of 2 meters. If her father weighs 90 kg, where should he sit to keep the seesaw balanced?

67 cm from the fulcrum (Correct answer)
67 cm from the girl
267 cm from the fulcrum
133 cm from the girl

Correct answer: 67 cm from the fulcrum

In order for the seesaw to be balanced, the torque due to the girl (τg ) must be exactly counteracted by the torque due to her father (τf ). In other words, the magnitudes of these torques must be equal (τg = τf ): Because r represents the distance of each person from the fulcrum, the father must sit 67 cm from the fulcrum.

Question 25: A redox titration differs from other titrations in that it involves:

the determining of an unknown concentration in one reactant
the use of a known concentration
the quantitative analysis of a substance
the use of oxidation and reduction (Correct answer)

Correct answer: the use of oxidation and reduction

The correct answer is D: Explanation: This is the only answer choice that is unique to a redox titration. The other choices are common to various types of titrations.

MCAT (Chemical and Physical Foundations)

While investigating mining samples off the coast of Columbia, a scientist discovers an element that has never been detected by humans.
The molecule possesses an electronegativity similar to iron, according to extensive testing (Fe).
What would the following values be regarding magnesium if the characteristics of this element were found to be consistent with iron? Make
use of the periodic table as a guide.